ORFeome > loc100144286 ORF1 – XORFeome v1.0

loc100144286 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: loc100144286
Gene ID: 5730457
Gene Page ID: 5730431
ORF Xenbase ID: 17282325

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC097796
Original XGC clone length: 948

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ838389
dbEST ID: 79656091
Trimmed Sequence: ATGGGGTTCTGTTATTATCGCAGTTATGCCAAGAAGGAGCAACAGTTTGTGAGAATGGCCAGGACATTGAATTTGGCCACTTTCCTGGGGACATCAGGTTTATTGCTGCGCTCTCTCATTTGGCTATGTGCTCCAGAGTTTTTATTCAGCCAGAAGACTTGGTTCCCCAGAGCTGTTTGTGTGCTCATTTCAACATGGATCCATTATTTCTATTCTGTTCTGTTCTGGGCATTTTTCTGCTTCTCTCTGGAGGTAGCTCAGCTGTTCAGCCCCAATCCAGAGAGGTTCAGAAAACTGTATGCATTTGTATGTTGGGGGGCCCCAAGTCTGCTATGGCTTCATGGGTTCCTAATTCTTGGGCTTCCTAATACACCTGAAGACAGCTGTGACTCTAAACAAAGCCTTGTGCTGTTCCATGATGTTCTTGTGTATATCCCCTTCATGTTTGCATTGCTGGGAAGTCCATTGCTTCTACGACACACCATCACGAAAGTGACAGTTGTGCTGAGGATGAGGTGTGGGATGTACACCACCACTCATCGTTTCATGGAGGAGGGTAAACGCACAAAGATTATAGGGATCTACAGCGCGTGCTTATCTAACTGGATTGGTATTTTTGGATGTTAGGTGATTATGGTTCCACCCAAACCTAAGGTGCGCGACCCGAGGTGCCCCCCCAAATG
Full Trace Sequence: CGAGGGCCACATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGTTCTGTTATTATCGCAGTTATGCCAAGAAGGAGCAACAGTTTGTGAGAATGGCCAGGACATTGAATTTGGCCACTTTCCTGGGGACATCAGGTTTATTGCTGCGCTCTCTCATTTGGCTATGTGCTCCAGAGTTTTTATTCAGCCAGAAGACTTGGTTCCCCAGAGCTGTTTGTGTGCTCATTTCAACATGGATCCATTATTTCTATTCTGTTCTGTTCTGGGCATTTTTCTGCTTCTCTCTGGAGGTAGCTCAGCTGTTCAGCCCCAATCCAGAGAGGTTCAGAAAACTGTATGCATTTGTATGTTGGGGGGCCCCAAGTCTGCTATGGCTTCATGGGTTCCTAATTCTTGGGCTTCCTAATACACCTGAAGACAGCTGTGACTCTAAACAAAGCCTTGTGCTGTTCCATGATGTTCTTGTGTATATCCCCTTCATGTTTGCATTGCTGGGAAGTCCATTGCTTCTACGACACACCATCACGAAAGTGACAGTTGTGCTGAGGATGAGGTGTGGGATGTACACCACCACTCATCGTTTCATGGAGGAGGGTAAACGCACAAAGATTATAGGGATCTACAGCGCGTGCTTATCTAACTGGATTGGTATTTTTGGATGTTAGGTGATTATGGTTCCACCCAAACCTAAGGTGCGCGACCCGAGGTGCCCCCCCAAATG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGTTCTGTTATTATCGCAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838388
dbEST ID: 79656090
Trimmed Sequence: TTCACTGGCAGACGCCCACAGATCCATAAGTTTTGATATGTTTGGCAAGGTCATCTTCGCTATGGCCTGAGCTTGCTCCGTATTCAGCAAGTGCCTCTTCTCCTGTAAAGACCCTGAATAATCCTCCTTTGAGCTACTGTCACAGGTGGAGATATGACCGAGAGTTCCTCCGCTCCTCCAATCAAGAAAAGCCAAAGAATGAAGACAGCAATACATGGGGTTCATTATACCCATAATGACCCATAATGTCAGAGCTGCCACCTTCATCTGTTGGGGAGCCTGTGTGCCCCCATGAAGCTCCACTAGAAGCAGCAGAAAATCACATACAATGTTGCAAATCCAGCAGGTTATGAAAGCGCTGCAGATCTGTATAAACCTTCTGCGTAAACTGTGCTCCCTGAAACGCTCACTGCTGGTGTATATCCCACACCTCATCCTCAGCACAACTGGCACTTTCGTGATGGTGTGTCGTAGAAGCAATGGACTTCCCAACAATGCAAACCATGAAGGGAGATACACAAGAACATCATGGAAGACCACAAGGCTTTGTGTAGAGTCACAGCTGTCTTCAGGTGTATTAGGGAGCCCAGGAGTTAGGACCCATGAAGCCGTAGCAAACTTGGGGCCCCCCGAGGGCGAGTGGAGAAAGGGTTTCGGAAACTCCTCTGGAATGGGGGGGGGAAGA
Full Trace Sequence: GGGGAAAAGTCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCACTGGCAGACGCCCACAGATCCATAAGTTTTGATATGTTTGGCAAGGTCATCTTCGCTATGGCCTGAGCTTGCTCCGTATTCAGCAAGTGCCTCTTCTCCTGTAAAGACCCTGAATAATCCTCCTTTGAGCTACTGTCACAGGTGGAGATATGACCGAGAGTTCCTCCGCTCCTCCAATCAAGAAAAGCCAAAGAATGAAGACAGCAATACATGGGGTTCATTATACCCATAATGACCCATAATGTCAGAGCTGCCACCTTCATCTGTTGGGGAGCCTGTGTGCCCCCATGAAGCTCCACTAGAAGCAGCAGAAAATCACATACAATGTTGCAAATCCAGCAGGTTATGAAAGCGCTGCAGATCTGTATAAACCTTCTGCGTAAACTGTGCTCCCTGAAACGCTCACTGCTGGTGTATATCCCACACCTCATCCTCAGCACAACTGGCACTTTCGTGATGGTGTGTCGTAGAAGCAATGGACTTCCCAACAATGCAAACCATGAAGGGAGATACACAAGAACATCATGGAAGACCACAAGGCTTTGTGTAGAGTCACAGCTGTCTTCAGGTGTATTAGGGAGCCCAGGAGTTAGGACCCATGAAGCCGTAGCAAACTTGGGGCCCCCCGAGGGCGAGTGGAGAAAGGGTTTCGGAAACTCCTCTGGAATGGGGGGGGGAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCACTGGCAGACGCCCAC