ORFeome > lsm5 ORF1 – XORFeome v1.0

lsm5 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: lsm5
Gene ID: 5941032
Gene Page ID: 5941005
ORF Xenbase ID: 17282703

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078466
Original XGC clone length: 276

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ839740
dbEST ID: 79657442
Trimmed Sequence: ATGGCGGCTACCGTGCCTCCCAATTCGTCGCAACTTCTCCCGCTCGAACTTGTGGACAAGTGCATAGGATCTCGCATCCATATCGTTATGAAGAGTGATAAAGAAATTGTTGGCACCCTTCTTGGCTTTGATGATTTTGTCAACATGGTGTTAGAAGATGTTACAGAATTTGAAATCACACCGGAAGGAAGGCGAATTACAAAACTCGATCAAATATTACTGAATGGAAATAACATAACTATGCTGGTGCCTGGAGGTGAAGGTCCTGAAGTATT
Full Trace Sequence: CTCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTACCGTGCCTCCCAATTCGTCGCAACTTCTCCCGCTCGAACTTGTGGACAAGTGCATAGGATCTCGCATCCATATCGTTATGAAGAGTGATAAAGAAATTGTTGGCACCCTTCTTGGCTTTGATGATTTTGTCAACATGGTGTTAGAAGATGTTACAGAATTTGAAATCACACCGGAAGGAAGGCGAATTACAAAACTCGATCAAATATTACTGAATGGAAATAACATAACTATGCTGGTGCCTGGAGGTGAAGGTCCTGAAGTATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGAAACGTGTCACAAAAACTCTGATGTTACAGCTCCTAAGGCCGGGCGGAAAGAAAAAATAGGCTCACGGAAAACAAGGGTCTTGGGGTTTCCCAGGTGGTGAAGGAAAAAAGGCCCAACACAGCGAACCCACCGGAGGGGTTGTAAGGGGAAAAAAAAAGGGAGGGAGGGGAGAAAACGGCCCAAAAACTGGGAAAAAAACCGGGGGACGGGCGAGAGAGGGGTTTTAGGGGGTGTTTATTGGTTTTTTTAGAAAAATTGGTGCCCAAAAACCAAACAAAAAAGGGGCGGGGGGGGGGGGAGGGGGGGGAGGGGGGGGGGGTTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTACCGTGCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839739
dbEST ID: 79657441
Trimmed Sequence: TACTTCAGGACCTTCACCTCCAGGCACCAGCATAGTTATGTTATTTCCATTCAGTAATATTTGATCGAGTTTTGTAATTCGCCTTCCTTCCGGTGTGATTTCAAATTCTGTAACATCTTCTAACACCATGTTGACAAAATCATCAAAGCCAAGAAGGGTGCCAACAATTTCTTTATCACTCTTCATAACGATATGGATGCGAGATCCTATGCACTTGTCCACAAGTTCGAGCGGGAGAAGTTGCGACGAATTGGGAGGCACGGTAGCCGCCATGG
Full Trace Sequence: GGGGTAACAGCTATGGACCATGTAATACGACTCACTATAGGGGATATCNAGCTGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACTTCAGGACCTTCACCTCCAGGCACCAGCATAGTTATGTTATTTCCATTCAGTAATATTTGATCGAGTTTTGTAATTCGCCTTCCTTCCGGTGTGATTTCAAATTCTGTAACATCTTCTAACACCATGTTGACAAAATCATCAAAGCCAAGAAGGGTGCCAACAATTTCTTTATCACTCTTCATAACGATATGGATGCGAGATCCTATGCACTTGTCCACAAGTTCGAGCGGGAGAAGTTGCGACGAATTGGGAGGCACGGTAGCCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGCGCCCGACCTTAATAAAAACCAGACAAAAACAACTATATCACCGAGGTCGCGAAATACCCGGGCAGACAAAAAAAAAAGAATTCCCTGGAACCAGGGGCGCCGGGTGTAATCGTCGTGGGAAGGGGAAAGGAGACCAGAAACAGGCGAAACAAGCCGGGTCGGGTCGGAATTTGGATGGAAAAACGTAGGGGGGCGCCCCACTGGGTCAAAAACTTAGAAAAAACAAGGGGGGGGGGGGGGGGGGGGGGTTTTCGGTTTTGGTTAAAATTTTTTTTTGGGTTTGTTTTTTTCGCTCGGCATCCCCACAACAACACCGGCCTCCCCATGGGGGGCTGGTTTGGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACTTCAGGACCTTCACCTCCA