ORFeome > MGC53682 ORF2 – XORFeome v1.0

MGC53682 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256339
Gene Page ID:
ORF Xenbase ID: 17258223

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106626
Original XGC clone length: 480

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ837652
dbEST ID: 79655354
Trimmed Sequence: ATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCGCTGACAGGATGCAAAGCGCCGGCAAAGCCCTGCATGAACTGCTCGTCTCTGCCCAGAGACAGGAGTGTCTGACCGTTGGAGTCTGTGAGTCTGCCAAAGTCATGAATGTAGATCCAGATAGCGTCACTTTCTGCATTTTGGCTGCTGACGAATACGATGAGGGAGACATAGCCCTTCAGATCCACTTCACTCTGATTCAGGCTTTCTGCTGCGAAAATGACATCAATATAGTGAGGCTGAACGACACCGAAAAAGTCGCTCAAATTCTAGGGTTCACTGATGAGTCTGCAGAGCCCAAGGACCTTCACTGCATTCTTATTACGAATCCAAATGAGGATGCCTGGAAAGATCCAGCTCTGGAGAAACTTGCTGTATTCTGCGAGGAAAGCCGTAAAGTCTATGACTGGGTTCCCACTATTGCCCTGCCCGAGTT
Full Trace Sequence: CTCGAGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCGCTGACAGGATGCAAAGCGCCGGCAAAGCCCTGCATGAACTGCTCGTCTCTGCCCAGAGACAGGAGTGTCTGACCGTTGGAGTCTGTGAGTCTGCCAAAGTCATGAATGTAGATCCAGATAGCGTCACTTTCTGCATTTTGGCTGCTGACGAATACGATGAGGGAGACATAGCCCTTCAGATCCACTTCACTCTGATTCAGGCTTTCTGCTGCGAAAATGACATCAATATAGTGAGGCTGAACGACACCGAAAAAGTCGCTCAAATTCTAGGGTTCACTGATGAGTCTGCAGAGCCCAAGGACCTTCACTGCATTCTTATTACGAATCCAAATGAGGATGCCTGGAAAGATCCAGCTCTGGAGAAACTTGCTGTATTCTGCGAGGAAAGCCGTAAAGTCTATGACTGGGTTCCCACTATTGCCCTGCCCGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACAGGGTCATAGCTTTTTTAAAAAAAAAACCGGCACGAGTCTACAAATCCCTGAATGTAACAACAGGGGGGGNAANNNNCCCCNGGTTCGTCTCCACAAGGGGGCGCGTGCAAAATACCTTGTGGTAGAGAGAAGAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCTGGAAGAAGTTCACGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837651
dbEST ID: 79655353
Trimmed Sequence: CTCGGGCAGGGCAATAGTGGGAACCCAGTCATAGACTTTACGGCTTTCCTCGCAGAATACAGCAAGTTTCTCCAGAGCTGGATCTTTCCAGGCATCCTCATTTGGATTCGTAATAAGAATGCAGTGAAGGTCCTTGGGCTCTGCAGACTCATCAGTGAACCCTAGAATTTGAGCGACTTTTTCGGTGTCGTTCAGCCTCACTATATTGATGTCATTTTCGCAGCAGAAAGCCTGAATCAGAGTGAAGTGGATCTGAAGGGCTATGTCTCCCTCATCGTATTCGTCAGCAGCCAAAATGCAGAAAGTGACGCTATCTGGATCTACATTCATGACTTTGGCAGACTCACAGACTCCAACGGTCAGACACTCCTGTCTCTGGGCAGAGACGAGCAGTTCATGCAGGGCTTTGCCGGCGCTTTGCATCCTGTCAGCGCTTTCAACAACGGTTTCTTGTCCGTGAACTTCTTCCAGAGTCATGG
Full Trace Sequence: GGGGCGGGTAACAGCTTATGAACATTGTACAACGACTCACTACTAGGGGAAACCAGCTTGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCGGGCAGGGCAATAGTGGGAACCCAGTCATAGACTTTACGGCTTTCCTCGCAGAATACAGCAAGTTTCTCCAGAGCTGGATCTTTCCAGGCATCCTCATTTGGATTCGTAATAAGAATGCAGTGAAGGTCCTTGGGCTCTGCAGACTCATCAGTGAACCCTAGAATTTGAGCGACTTTTTCGGTGTCGTTCAGCCTCACTATATTGATGTCATTTTCGCAGCAGAAAGCCTGAATCAGAGTGAAGTGGATCTGAAGGGCTATGTCTCCCTCATCGTATTCGTCAGCAGCCAAAATGCAGAAAGTGACGCTATCTGGATCTACATTCATGACTTTGGCAGACTCACAGACTCCAACGGTCAGACACTCCTGTCTCTGGGCAGAGACGAGCAGTTCATGCAGGGCTTTGCCGGCGCTTTGCATCCTGTCAGCGCTTTCAACAACGGTTTCTTGTCCGTGAACTTCTTCCAGAGTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAGTTTGTTGGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGGCCCAAAAAAAGGACAAGCCGTGCGATTGACACGTCGGGGACGTGGGAGGGGGGGGGGGGAAAAGAAAACGAGCGCGTCGGTGCGAACAAGGGGTGCTGGGGGGCGGACGTGGGGGAGAAGAGAAAAGAGCAGAGAGCAGGGGAGAAAAGGGGGGGGGGGGGGGGGAGGGGGGAGGGAGAAGAAGAGAGGGGGCGCGAGGGGGGGGGGAGAAAAAGGGGCGAGACCGGTGGGGTGGGGGGGGGGGGGGGGGGAAAGGCGGGGGAGGGGAGGGGGGGGGGGGGGGGGGGAGGGGGGAGGGAGGGGAGGCGGAGGGGGGGGGGGGGGCGGGGGAGGGGGGGAGAGGGGGCGGGAGGGGGAGGGGGGGGAAGGGGGGAGGGGGGGCGGGGGGGGGNGGGGAGGGGGGGGGAGGGGAGGGGAGGGGGAGGGGAGGAGGGAGGGGGGGANGAGAAGGGGAGGAGGGAGGGAAGAGGAGCAGGGGGGGGGGGAGGGGGGAGGGAGGAGNAGAGAGAGGGAGGGGGGGGGGGAGGGANGGGGAAAGGGAGNGGGGGAGGGAGGAGAAGAAGAGGNAGNNGNGAGGGAGAGGAGGGNGAAAGGGGGAAGGAGGGGAGNNNGGGGGGAGGGGGAGGGGTGANGGAGGGGGGGAGGGAAGGGGGAGCGGGGGGAGAGGGGGGAGGGGGNAGNGNAGGNGGNGNGGAGGAGNGGANGGNNGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCGGGCAGGGCAATAGT