ORFeome > MGC64477 ORF1 – XORFeome v1.0

MGC64477 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6255796
Gene Page ID:
ORF Xenbase ID: 17258481

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054260
Original XGC clone length: 1131

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ839509
dbEST ID: 79657211
Trimmed Sequence: ATGTCCACTGTTGGAAAGGTTATCCACTGCAAAGCGGCAGTTGCCCTGGAGGCTAAAAAACCACTTGTTATACAGCAAATTGAAGTTGCTCCACCAAAGGCTAAAGAAATCCGTATCAAGATTTACCACAGTGGCATTTGCCATTCAGATGACCATGCTCTAGGGGGTTTTATGGCTGGTATTAAATTTCCAATTATTTTGGGACACGAGGGAGCTGGAGTTGTTGAGAGTGTTGGAGAAGGGGTAACAAGTGTGGAACCAGGAGATCATGTCATCGCAATATGCAGTCCAATGTGCATGAAGTGTCCAAGCTGCTTGCATCCCGACAGCAACTTCTGCGTGCAAAATGACGTCGGCAAGAATGTTGGAATGATGCTGGACAAAACCAGCAGATTTTCCATCAACGGCAAGATGATTCACAACTTTATGTCCACAAGCACATTCTGTGAATACACAGTTCTGGATGAATTTGCTTGTGTTAAGATTGACTGCAAGGCTCCCTTGTATGAAGTGTGCCTGATTGGCTGTGGGTTTTCCACTGGTTATGGATCAGTACTCAACACTGCTAAAGTACAGCAAGGTAGCTCTTGTGCAGTGTTTGGGTTTGGGTGGAATAGGAATGTCTGCTGTTATGGGCTGCAAAGTTGCTGGAGCATCACGAATCAATGGAGTAGACATCAATAAAGGAAAATTGAAATTGCCCAAAAAATTGGAATCCCTGAATGCCTGGACCCCAACGATTAGAAAAACCAATCCCATAAGTTATTCAAAATGAAAAAAAAGGGGGGAGTTAAAATATCCATTTGAATTCCTTTTGAAAAAATT
Full Trace Sequence: CCGGGGCCCAAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCACTGTTGGAAAGGTTATCCACTGCAAAGCGGCAGTTGCCCTGGAGGCTAAAAAACCACTTGTTATACAGCAAATTGAAGTTGCTCCACCAAAGGCTAAAGAAATCCGTATCAAGATTTACCACAGTGGCATTTGCCATTCAGATGACCATGCTCTAGGGGGTTTTATGGCTGGTATTAAATTTCCAATTATTTTGGGACACGAGGGAGCTGGAGTTGTTGAGAGTGTTGGAGAAGGGGTAACAAGTGTGGAACCAGGAGATCATGTCATCGCAATATGCAGTCCAATGTGCATGAAGTGTCCAAGCTGCTTGCATCCCGACAGCAACTTCTGCGTGCAAAATGACGTCGGCAAGAATGTTGGAATGATGCTGGACAAAACCAGCAGATTTTCCATCAACGGCAAGATGATTCACAACTTTATGTCCACAAGCACATTCTGTGAATACACAGTTCTGGATGAATTTGCTTGTGTTAAGATTGACTGCAAGGCTCCCTTGTATGAAGTGTGCCTGATTGGCTGTGGGTTTTCCACTGGTTATGGATCAGTACTCAACACTGCTAAAGTACAGCAAGGTAGCTCTTGTGCAGTGTTTGGGTTTGGGTGGAATAGGAATGTCTGCTGTTATGGGCTGCAAAGTTGCTGGAGCATCACGAATCAATGGAGTAGACATCAATAAAGGAAAATTGAAATTGCCCAAAAAATTGGAATCCCTGAATGCCTGGACCCCAACGATTAGAAAAACCAATCCCATAAGTTATTCAAAATGAAAAAAAAGGGGGGAGTTAAAATATCCATTTGAATTCCTTTTGAAAAAATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCACTGTTGGAAAGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839508
dbEST ID: 79657210
Trimmed Sequence: CATATCCAGGACTGCACGGACACATTTTCCCTGGCGCATGAGTTCAAAGCCATCCATTATTTTATCAAACTTCACCCTATGTGTCACCAAAGCTTTAAGGGGAAATTTTTTCTTCATAGCATCTTGCACTAAGCGAGGGAAAGCCTCCTTTGCCTTCCAGTCTCCAAGGAAAGCTCCCTTCACTGTACGCCCAGTGAGTAGCCACATAAGATCAAGAGAAAGTCGAGCGGTTGATGGAGGGACACCAATAATGGTTGCACAACCGAATGAAAAATGACAGGCTTGAATAACAGATGCCATCAATTCAACTTTTCCAACGCATTCAAATGAGTAATCAACTCCCCCATTAGTCATTTCTGCAATAACCTCATGGATTGGTTTATCATAATCGTTTGGGTCCAGGCATTCAGTGCATCCCAACTTCTTGGCAATTTCAAATTTTCCTTTATTGATGTCTACTCCAATGATTCGTGATGCTCCAGCAACTTTGCAGCCCATAACAGCAGACATTCCTATTCCACCCAAACCAAACACTGCACAAGAGCTACCTTGCTGTACTTTAGCAGTGTTGAGTACTGATCCATAACCAGTGGAAAACCCACACCCCATCAGGCACACTTTCTAACAAGGAAGCCCTGCAGTCCATCTTAACACAAGCCAATTTCATCCAAAACTGTGTAATCACAGAAAGTTGGCCTGGGGAACATAAAGTTTTGAAATTAACCTTTGCCCCTTCAAAGGAAAAAACTGGGCCGGGGTTTTGTG
Full Trace Sequence: AAACAAGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATATCCAGGACTGCACGGACACATTTTCCCTGGCGCATGAGTTCAAAGCCATCCATTATTTTATCAAACTTCACCCTATGTGTCACCAAAGCTTTAAGGGGAAATTTTTTCTTCATAGCATCTTGCACTAAGCGAGGGAAAGCCTCCTTTGCCTTCCAGTCTCCAAGGAAAGCTCCCTTCACTGTACGCCCAGTGAGTAGCCACATAAGATCAAGAGAAAGTCGAGCGGTTGATGGAGGGACACCAATAATGGTTGCACAACCGAATGAAAAATGACAGGCTTGAATAACAGATGCCATCAATTCAACTTTTCCAACGCATTCAAATGAGTAATCAACTCCCCCATTAGTCATTTCTGCAATAACCTCATGGATTGGTTTATCATAATCGTTTGGGTCCAGGCATTCAGTGCATCCCAACTTCTTGGCAATTTCAAATTTTCCTTTATTGATGTCTACTCCAATGATTCGTGATGCTCCAGCAACTTTGCAGCCCATAACAGCAGACATTCCTATTCCACCCAAACCAAACACTGCACAAGAGCTACCTTGCTGTACTTTAGCAGTGTTGAGTACTGATCCATAACCAGTGGAAAACCCACACCCCATCAGGCACACTTTCTAACAAGGAAGCCCTGCAGTCCATCTTAACACAAGCCAATTTCATCCAAAACTGTGTAATCACAGAAAGTTGGCCTGGGGAACATAAAGTTTTGAAATTAACCTTTGCCCCTTCAAAGGAAAAAACTGGGCCGGGGTTTTGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATATCCAGGACTGCACGGAC