ORFeome > mpz ORF1 – XORFeome v1.0

mpz ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mpz
Gene ID: 876975
Gene Page ID: 876968
ORF Xenbase ID: 17284665

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129641
Original XGC clone length: 738

Human orthology & disease relationships

NCBI Entrez ID: 4359
Ensembl gene IDs: ENSG00000158887,LRG_256
Directly associated (OMIM) disease MIM numbers: 118200,145900,180800,605253,607677,607736,607791
Indirectly associated (Lage, et al.) disease MIM numbers: 145900

Library Location

Plate ID: GDExl11091
Well Location: F01

Sequences - 5ʹ (forward) EST

Accession: JZ838631
dbEST ID: 79656333
Trimmed Sequence: ATGGAACCCTCAGGACTAAGGACACCATGTTCCCTTCTGGCTCTGGTTCTGCTCTCAGCACTGGTGCTGACTCCAACCCTGGCAATTGAAGTTTACACCGATCGAGAGGTCTATGGGACCGCGGGCTCCAGGGTGACCTTGTCCTGCTCATTCTGGTCAAGCGAATGGATCTCAGACGATATCTCCGTCACTTGGCACTATCAGCCCGACCACAGCCGCGAAATGTATTCGATAGTCCACTTTGCCAAGGGTCTATCTTCCATTGATGCTGGGATCTTCAAAGATCGTATCGAATGGGTGGGCTCCCCAAAATGGAAGGACGCCAGCATTGTGGTGCACAACCTGGAGTTAACTGACAACGGCACTTTCACCTGTGATGTGAAGAACCCACCCGATGTGGTGGGAAAGTCTTCCTATGTCCACCTTCAAGTCCAAGAGAAAGGTCCTGCTCGTGCTGGGCTGATTCTGGGGATCATAATTGCTGTTGCCCTGGCCTTAGTCATTGTGGTGACAATTCCTCATCCTGCTCATTCGATACTGCTTGTTTAAGAAAAAGGCCCGAGTACAGAGGGAACTTAATGCACTTGAAAGGGAAAAATTACACAAGAAAAAAATTCATCCAACGCAATTGCAAAACAAACCCCGATTCTCTAAGCCTTTTAATACGAACCCAAAAACAATATGAAGCAGAATAAAGGCCCAAAGCCGGGCATCGGGAACACCCCCCAAGGAAGTGAAGATTGCGCAGATTTCTTTTTCCAAAAATTTGGGGATTTAAAAA
Full Trace Sequence: TCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAACCCTCAGGACTAAGGACACCATGTTCCCTTCTGGCTCTGGTTCTGCTCTCAGCACTGGTGCTGACTCCAACCCTGGCAATTGAAGTTTACACCGATCGAGAGGTCTATGGGACCGCGGGCTCCAGGGTGACCTTGTCCTGCTCATTCTGGTCAAGCGAATGGATCTCAGACGATATCTCCGTCACTTGGCACTATCAGCCCGACCACAGCCGCGAAATGTATTCGATAGTCCACTTTGCCAAGGGTCTATCTTCCATTGATGCTGGGATCTTCAAAGATCGTATCGAATGGGTGGGCTCCCCAAAATGGAAGGACGCCAGCATTGTGGTGCACAACCTGGAGTTAACTGACAACGGCACTTTCACCTGTGATGTGAAGAACCCACCCGATGTGGTGGGAAAGTCTTCCTATGTCCACCTTCAAGTCCAAGAGAAAGGTCCTGCTCGTGCTGGGCTGATTCTGGGGATCATAATTGCTGTTGCCCTGGCCTTAGTCATTGTGGTGACAATTCCTCATCCTGCTCATTCGATACTGCTTGTTTAAGAAAAAGGCCCGAGTACAGAGGGAACTTAATGCACTTGAAAGGGAAAAATTACACAAGAAAAAAATTCATCCAACGCAATTGCAAAACAAACCCCGATTCTCTAAGCCTTTTAATACGAACCCAAAAACAATATGAAGCAGAATAAAGGCCCAAAGCCGGGCATCGGGAACACCCCCCAAGGAAGTGAAGATTGCGCAGATTTCTTTTTCCAAAAATTTGGGGATTTAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACCCTCAGGACTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838630
dbEST ID: 79656332
Trimmed Sequence: TTTCCTATCTTTGCGGGAGTCGCCGATGCCGCCCTTGGCCTTCTTCTCGCTTGATTTGCCTCTGGTTTGGTCTAGCATGGCATAGAGAATCGGGGTCTGTCTGCTACTGCGTTTGGATGAATCTTTTGCTTTGTGTAATTTTCCCCTCTCAAGTGCACTAAGCTCCCTCTGTACTCGGGCCTTTCGTCTTAACCAGCAGTATCGAATGAGCAGGATGAGGATTGTCACCACAATGACTAAGGCCAGGGCAACAGCAATTATGATCCCCAGAATCAGCCCAGCACGAGCAGGACCTTTCTCTTGGACCTGAAGGTGGACATAGGAAGACTTTCCCACCACATCGGGTGGGTTCTTCACATCACAGGTGAAAGTGCCGTTGTCAGTTAACTCCAGGTTGTGCACCACAATGCTGGCGTCCTTCCATTTTGGGGAGCCCACCCATTCGATACGATCTTTGAAGATCCCAGCATCAATGGAAGATAGACCCTTGGCAAAGTGGACTATCGAATACATTTCGCGGCTGTGGTCGGGCTGATAGTGCCGAGTGACGGAGATATCGTCTGAAATCCATTCGCTTGACCAGAATGAACAGGACAAGATCACCCGGGACCCCGCGGTCCCGTAGACCCTCTCATCCGGGTAAACCTTCATTGCCAGGGTTTGAGATCGCACCAGGGGCGTAAAAGCGGAACCAAAAACCGAAGGGGAACGGGTTTGTCCTTTAATTCCTGAAAGGGTTCAATGGCCGGCGGGCGGTTTTTTTGG
Full Trace Sequence: GGTAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCCTATCTTTGCGGGAGTCGCCGATGCCGCCCTTGGCCTTCTTCTCGCTTGATTTGCCTCTGGTTTGGTCTAGCATGGCATAGAGAATCGGGGTCTGTCTGCTACTGCGTTTGGATGAATCTTTTGCTTTGTGTAATTTTCCCCTCTCAAGTGCACTAAGCTCCCTCTGTACTCGGGCCTTTCGTCTTAACCAGCAGTATCGAATGAGCAGGATGAGGATTGTCACCACAATGACTAAGGCCAGGGCAACAGCAATTATGATCCCCAGAATCAGCCCAGCACGAGCAGGACCTTTCTCTTGGACCTGAAGGTGGACATAGGAAGACTTTCCCACCACATCGGGTGGGTTCTTCACATCACAGGTGAAAGTGCCGTTGTCAGTTAACTCCAGGTTGTGCACCACAATGCTGGCGTCCTTCCATTTTGGGGAGCCCACCCATTCGATACGATCTTTGAAGATCCCAGCATCAATGGAAGATAGACCCTTGGCAAAGTGGACTATCGAATACATTTCGCGGCTGTGGTCGGGCTGATAGTGCCGAGTGACGGAGATATCGTCTGAAATCCATTCGCTTGACCAGAATGAACAGGACAAGATCACCCGGGACCCCGCGGTCCCGTAGACCCTCTCATCCGGGTAAACCTTCATTGCCAGGGTTTGAGATCGCACCAGGGGCGTAAAAGCGGAACCAAAAACCGAAGGGGAACGGGTTTGTCCTTTAATTCCTGAAAGGGTTCAATGGCCGGCGGGCGGTTTTTTTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCCTATCTTTGCGGGAGT