ORFeome > mysm1 ORF1 – XORFeome v1.0

mysm1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: mysm1
Gene ID: 1032962
Gene Page ID: 1032956
ORF Xenbase ID: 17285475

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125979
Original XGC clone length: 2457

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ838044
dbEST ID: 79655746
Trimmed Sequence: ATGGCCGAGGAAGCAGCCGATGTTGATATTGATATAGAGGGAGATATAAATGAATCCAGCAAGAGTATTTATGACAGCCTTAATACTGGATTTGCTCCCGAGCACTACATTGAATCTGCGTGGCAAAATGAAGAAGGCCTTGCTCCATGGGCATTGGACAGTTCAATCAGCGAAGAAAACAGAGAAGCAATTAAGAAAATGTTGCTTGAGGAAGAATATTATCTATCTAACAAGCCACTAGCAGTAAAGTTTTGGTCAGATTCACAAGAAGGAGAGAAGCAATGTATCAAAAGGGTACGATCCCCTGCTAAGGCTAGCAGTAGCCCAGTGAAATGGACTAAAGAAGAAAAAAATCTCTTTGTTTCCAAGATTACGAACCAAATGGACGACCGTCTCTTTT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGAGGAAGCAGCCGATGTTGATATTGATATAGAGGGAGATATAAATGAATCCAGCAAGAGTATTTATGACAGCCTTAATACTGGATTTGCTCCCGAGCACTACATTGAATCTGCGTGGCAAAATGAAGAAGGCCTTGCTCCATGGGCATTGGACAGTTCAATCAGCGAAGAAAACAGAGAAGCAATTAAGAAAATGTTGCTTGAGGAAGAATATTATCTATCTAACAAGCCACTAGCAGTAAAGTTTTGGTCAGATTCACAAGAAGGAGAGAAGCAATGTATCAAAAGGGTACGATCCCCTGCTAAGGCTAGCAGTAGCCCAGTGAAATGGACTAAAGAAGAAAAAAATCTCTTTGTTTCCAAGATTACGAACCAAATGGACGACCGTCTCTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCAAAAAAAAAAATAAGCGATGTCTCAAATCTCCGATGTTACACCGCGGGGGGGTTTGCTCCCTCTTTCGTCCCCCCGGGAGGGGGGTGGGGCCGTCTTTGGGGAAAAAAAGAGGGAGAAACCCAAGAAAAATAACTTTGCGTGGGGCAAGGTAAATAAAATAAGGAAGGGGAACCAGGGAGGGGGTCACAACTTTTTGCCAACCGCCGGGGGGGGGGGGGGGGGGGGGGGGGTTTCGCTGGGGTGTGGGAAGTATTTAGTGGGGAACGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGAGGAAGCAGCCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838043
dbEST ID: 79655745
Trimmed Sequence: AAGAGACGGTCGTCCATTTGGTTCGTAATCTTGGAAACAGAGAGATTTTTTTCTTCTTTAATCCATTTCACTGGGCTACTGCTAGCCTTAGCAGGGGATCGTACCCTTTTGATACATTGCTTCTCTCCTTCTTGTGAATCTGACCAAAACTTTACTGCTAGTGGCTTGTTAGATAGATAATATTCTTCCTCAAGCAACATTTTCTTAATTGCTTCTCTGTTTTCTTCGCTGATTGAACTGTCCAATGCCCATGGAGCAAGGCCTTCTTCATTTTGCCACGCAGATTCAATGTAGTGCTCGGGAGCAAATCCAGTATTAAGGCTGTCATAAATACTCTTGCTGGATTCATTTATATCTCCCTCTATATCAATATCAACATCGGCTGCTTCCTCGGTCATGG
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGAGACGGTCGTCCATTTGGTTCGTAATCTTGGAAACAGAGAGATTTTTTTCTTCTTTAATCCATTTCACTGGGCTACTGCTAGCCTTAGCAGGGGATCGTACCCTTTTGATACATTGCTTCTCTCCTTCTTGTGAATCTGACCAAAACTTTACTGCTAGTGGCTTGTTAGATAGATAATATTCTTCCTCAAGCAACATTTTCTTAATTGCTTCTCTGTTTTCTTCGCTGATTGAACTGTCCAATGCCCATGGAGCAAGGCCTTCTTCATTTTGCCACGCAGATTCAATGTAGTGCTCGGGAGCAAATCCAGTATTAAGGCTGTCATAAATACTCTTGCTGGATTCATTTATATCTCCCTCTATATCAATATCAACATCGGCTGCTTCCTCGGTCATGGTGCCGACTTTTTTGTACAAAATTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCATTAATTTGAAAAAAAAGAAAAAAAATAAGCATAGTTTTACTCTCCTTTAAAGGACCAGGGGGGAATATCTCCCCTTGCGTCTTCCAAAGGGGGGGGGGTTCATACAAAGAAAAGATAAGGGGGGGACAACCCGCTGAACAGAAACTGCTGGGGTGAAAAGATGGAAAGGGAAATAAGTAAAGCGCCACGCAACCGGCCTGGGACCCGAGTCGGGAGAGGGGGTGGGTGGAAGTGTAAGGGAGAGGTATTTGTTTGGTGTGGGGGGTGTGGGTGNGTGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGAGACGGTCGTCCATT