ORFeome > nek2 ORF1 – XORFeome v1.0

nek2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nek2
Gene ID: 962781
Gene Page ID: 962773
ORF Xenbase ID: 17286093

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043822
Original XGC clone length: 1329

Human orthology & disease relationships

NCBI Entrez ID: 4751
Ensembl gene IDs: ENSG00000117650
Directly associated (OMIM) disease MIM numbers: 615565
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11014
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ824202
dbEST ID: 79641904
Trimmed Sequence: ATGCCGTCACGGGTCGAGGATTATGAAGTCTTGTACACGATCGGCTCCGGCTCCTACGGGAAATGCCAGAAGATTCGCAGGAGGTCGGACGGGAAGCTGTTGGTATGGAAAGAACTGGACTATGGAACAATGACGGAGGCAGAGAAACAGATGCTGGTCTCTGAAGTGAACCTGCTGCGAGAACTCAAGCACCCAAACATCGTCCGCTATTATGACCGCATCATCGATCGGACAAACACTACTCTGTACATAGTGATGGAGTACTGCGAGGGGGGGGACCTGGCCAGCCTCATTGCTAAATGCACTAAAGAAAGGCAATATTTAGAAGAAGACTTTATCCTACGTATGTTTTGCCAACTGGCCCTGGCCCTTAAAGATTGCCATAAAAGGAGTGATGGTGGCCACACTGTGTTGCATCGAGACCTGAAACCTGCCAACATATTTCTAGATGCCAAAAACAATGTGAAGCTTGGAGACTTTGGACTGGCCAGAATACTGCATCATGACTCGAGTTTCGCAAAGACTTTTGTCGGCACCCCATATTACATGTCCCCAGAACAGATGAACAGAATGTCGTACAATGAGAAATCCGATATCTGGTCGTTGGGATGCCTCCTGTATGAACTCTGTGCTCTCTCGCCTCCGTTTACNGCTTACATCAAAAGGAGCTGGCAGAAAGATCAGAGAAAGGACGGTTTAAGCGCATTCCATATCGCTATTCCGAAGAGCTTAATCAAGTATTCCCGAAAAGCTTCATCTTAAGGGGACATATTTAAGGCCTTCTTTTTAAAAAAAATTTTTGCCCTCCCTTTTTTTTATTGGAAAGTTTTTTTG
Full Trace Sequence: CAATATATGATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGTCACGGGTCGAGGATTATGAAGTCTTGTACACGATCGGCTCCGGCTCCTACGGGAAATGCCAGAAGATTCGCAGGAGGTCGGACGGGAAGCTGTTGGTATGGAAAGAACTGGACTATGGAACAATGACGGAGGCAGAGAAACAGATGCTGGTCTCTGAAGTGAACCTGCTGCGAGAACTCAAGCACCCAAACATCGTCCGCTATTATGACCGCATCATCGATCGGACAAACACTACTCTGTACATAGTGATGGAGTACTGCGAGGGGGGGGACCTGGCCAGCCTCATTGCTAAATGCACTAAAGAAAGGCAATATTTAGAAGAAGACTTTATCCTACGTATGTTTTGCCAACTGGCCCTGGCCCTTAAAGATTGCCATAAAAGGAGTGATGGTGGCCACACTGTGTTGCATCGAGACCTGAAACCTGCCAACATATTTCTAGATGCCAAAAACAATGTGAAGCTTGGAGACTTTGGACTGGCCAGAATACTGCATCATGACTCGAGTTTCGCAAAGACTTTTGTCGGCACCCCATATTACATGTCCCCAGAACAGATGAACAGAATGTCGTACAATGAGAAATCCGATATCTGGTCGTTGGGATGCCTCCTGTATGAACTCTGTGCTCTCTCGCCTCCGTTTACNGCTTACATCAAAAGGAGCTGGCAGAAAGATCAGAGAAAGGACGGTTTAAGCGCATTCCATATCGCTATTCCGAAGAGCTTAATCAAGTATTCCCGAAAAGCTTCATCTTAAGGGGACATATTTAAGGCCTTCTTTTTAAAAAAAATTTTTGCCCTCCCTTTTTTTTATTGGAAAGTTTTTTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGTCACGGGTCGAGGATT

Sequences - 3ʹ (reverse) EST

Accession: JZ829507
dbEST ID: 79647209
Trimmed Sequence: GCGCATGCCCAGTATCTGCCGGCTCTTCAGCTGATAATTCTTTTCCAGCTCAGACAAAGCTTTGGCACGTAGGTTTGCAGCCTGCAGCCGTTTCTGCAAGTCGCTGCACTTCTCTTGCTCCAGATAGCGATCTGAACTGCGATTCTCTTTACTGTTACTCCCAAAATGAACATGGCGTCTGCTCCGCGTAGAGGAACTCTCTGTGTAGGCATCTATGCCATTTTCTAGGGCGGCTTGAAACAGGTGCTGTTCCTTCATCAAGTTAAAATTCTTCACCAGGCTTTCTGCCCTGGCAATTTTATCTTCTGCCATCCTTTCGCGCACGCAGAGTTCTCGTTCCCTTTGCTCCAGACGATCTTCCCTTTCCTTTAAGGCCCGCTCTCTTGATTGCAGTTGCTGTTCCTTTAACCGGAGCTCTGAGGGAACAGGGTCTGGCGTCGAGAGCCTTTCCTGCTCTGTGGCTTTCCATACCTTCTTTTCAGTTTTCTTTTGCTCTTCCCTGACAAACTCTGCTAATAAGTGATGCTGCAAAATTTCTTCTATAGAAGGCCTTAAATAGTCCTTTAGATGTAGCATGTTCGTGATTACTTGATTAAGCTCTTCTGAATAGCGATATGGAATGCGCCTAAACCGTCCTTCTCTGATCTTTTCTGCCAGCTCCTTTTTGATTGGTAAGCCGTAAACCGAAGGCAAAAAAACAACAAAATTTCATACCAGGAAGGCATCCCCAACCAACCAAGAATATCGGAAATTTTTTT
Full Trace Sequence: AACAGCTGCCAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGCATGCCCAGTATCTGCCGGCTCTTCAGCTGATAATTCTTTTCCAGCTCAGACAAAGCTTTGGCACGTAGGTTTGCAGCCTGCAGCCGTTTCTGCAAGTCGCTGCACTTCTCTTGCTCCAGATAGCGATCTGAACTGCGATTCTCTTTACTGTTACTCCCAAAATGAACATGGCGTCTGCTCCGCGTAGAGGAACTCTCTGTGTAGGCATCTATGCCATTTTCTAGGGCGGCTTGAAACAGGTGCTGTTCCTTCATCAAGTTAAAATTCTTCACCAGGCTTTCTGCCCTGGCAATTTTATCTTCTGCCATCCTTTCGCGCACGCAGAGTTCTCGTTCCCTTTGCTCCAGACGATCTTCCCTTTCCTTTAAGGCCCGCTCTCTTGATTGCAGTTGCTGTTCCTTTAACCGGAGCTCTGAGGGAACAGGGTCTGGCGTCGAGAGCCTTTCCTGCTCTGTGGCTTTCCATACCTTCTTTTCAGTTTTCTTTTGCTCTTCCCTGACAAACTCTGCTAATAAGTGATGCTGCAAAATTTCTTCTATAGAAGGCCTTAAATAGTCCTTTAGATGTAGCATGTTCGTGATTACTTGATTAAGCTCTTCTGAATAGCGATATGGAATGCGCCTAAACCGTCCTTCTCTGATCTTTTCTGCCAGCTCCTTTTTGATTGGTAAGCCGTAAACCGAAGGCAAAAAAACAACAAAATTTCATACCAGGAAGGCATCCCCAACCAACCAAGAATATCGGAAATTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGCATGCCCAGTATCTGCC