ORFeome > nle1 ORF1 – XORFeome v1.0

nle1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: nle1
Gene ID: 984064
Gene Page ID: 984058
ORF Xenbase ID: 17286447

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC044710
Original XGC clone length: 1431

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11016
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ824347
dbEST ID: 79642049
Trimmed Sequence: ATGAAGGAGGACGTGGGAAGACTTTTAATTCAATTTAAAAATGAAAACGGAGAGGGTCTGGGAACACCTTTTGATGTTCCTGTGGATATAACACCAGATAAACTGCAGTTAGTGTGCAATGCCCTTTTACAGGAGGAGGATCCAGTGCCTTTGGCCTTTTTTGTCCAAGATCTGGAAATCGTAACATCTCTGGATAAGACGTTGGAGAAGCAATCAGTTGAAACAGAAAAAGTGATTGACATAATCTATCAGCCACAAGCTGTGTTCAAAGTTCGTGCTGTAACACGATGTACCAGCTCATTGGAGGGACACACCGAGGCTGTTATTTCAGTAGCCTTCAGCCCAACTGGAAAGTATTTGGCAAGTGGTTCTGGGGACACTACAGTCCGCTTTTGGGATCTCAGCACAGAAACTCCACATTTTACATCTAAAGGGCATACACACTGGGTTCTCAGTATTGCTTGGTCTCCAGATGGCAAAAAACTTGCCTCAGGATGTAAAAATAGTCAGATCTTCATTTGGGACCCAAGCACAGGGAAGCAGATTGGCAAACCATTAACAGGGCACTCAAAGTGGATTACATGGCTGTGTTGGGAACCTCTCCACCTGAACCCAGAGAGCCGATACCTAGCCAGTGCCTCCAAAGATTGTACTATCCGTATCTGGGATACAGTTATGGGGCCAGTGTCAGAAGAATCCTACTAGCCACACGCCATCCGTACTGCAGTAAAAGGGGGGGGGGGGGTGGGAACCCCTTTTTTTTCCCTCCCAAAAAAGGACAATAAAAAGCTGAGAGGGACCGGGAGGGGGTCC
Full Trace Sequence: CAATATTGATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGAGGACGTGGGAAGACTTTTAATTCAATTTAAAAATGAAAACGGAGAGGGTCTGGGAACACCTTTTGATGTTCCTGTGGATATAACACCAGATAAACTGCAGTTAGTGTGCAATGCCCTTTTACAGGAGGAGGATCCAGTGCCTTTGGCCTTTTTTGTCCAAGATCTGGAAATCGTAACATCTCTGGATAAGACGTTGGAGAAGCAATCAGTTGAAACAGAAAAAGTGATTGACATAATCTATCAGCCACAAGCTGTGTTCAAAGTTCGTGCTGTAACACGATGTACCAGCTCATTGGAGGGACACACCGAGGCTGTTATTTCAGTAGCCTTCAGCCCAACTGGAAAGTATTTGGCAAGTGGTTCTGGGGACACTACAGTCCGCTTTTGGGATCTCAGCACAGAAACTCCACATTTTACATCTAAAGGGCATACACACTGGGTTCTCAGTATTGCTTGGTCTCCAGATGGCAAAAAACTTGCCTCAGGATGTAAAAATAGTCAGATCTTCATTTGGGACCCAAGCACAGGGAAGCAGATTGGCAAACCATTAACAGGGCACTCAAAGTGGATTACATGGCTGTGTTGGGAACCTCTCCACCTGAACCCAGAGAGCCGATACCTAGCCAGTGCCTCCAAAGATTGTACTATCCGTATCTGGGATACAGTTATGGGGCCAGTGTCAGAAGAATCCTACTAGCCACACGCCATCCGTACTGCAGTAAAAGGGGGGGGGGGGGTGGGAACCCCTTTTTTTTCCCTCCCAAAAAAGGACAATAAAAAGCTGAGAGGGACCGGGAGGGGGTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGAGGACGTGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829706
dbEST ID: 79647408
Trimmed Sequence: CTTCCTCCATATCCTTAGGCACTTATCTTTCCCTCCACTGGCTACTCTCTGTCCATCAGGACTCCAGTCAACAGAATATACCTCATCTGCATGGCCTGGGAGGTCTATCAAAAGCTTCTTGGTCTTCGAATCCCAAACTTTAAGTGTACTATCGCTGCTCCCACTGACCAAAAGTCTGCTGTCTGCCGACCAAGCTATCTGATAAACCGCTGACACATGGCCTCGTAAGGATGTCAAGAATTTTCCAGTTTTACCATCCCAAAGCTTGATTGATTTGTCAAAAGATGCACTAGCAATGATCCTTGTGTCAGGAGAAAAGAGAACTTCATTAATCAGGGCTTGATGTCCAGTCATCCTCTGCAAGGGCTTCTTTTCCTCTGCTGGGGCCCATAGAAACAGCGTGAAGTCATCAGAACCTGACACCAGTCTCTCAGGACCTTGGCCCCGGACTTCATTGTATCTTTTCAAGGCTTTCTCCTTCAAAACTTCCAATGAGCCACTCATGTCCTGTGGATTTACAGAAGCATCAGCTGGATTAAAAGCCCCTGTGCGGAGCACATAGTCTGTACTGAGTGCCATTGTGTTAACCCAGTGTGCATGACCTTGCAAATGTCTGCAAAGGACTCCATCCTGTGCTCTCCAGGCTTTTATTGCCCTGTCCTTGTGAGGAAGAATAAAAGGAGTTCATTCACACCCCAATTTTACTGCATTAAACTGGACTGCCTTTGGTGGCCATGTTAAGGGAACCTTTTTGAAACCCGGGCCCCCA
Full Trace Sequence: CGGGCAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCCTCCATATCCTTAGGCACTTATCTTTCCCTCCACTGGCTACTCTCTGTCCATCAGGACTCCAGTCAACAGAATATACCTCATCTGCATGGCCTGGGAGGTCTATCAAAAGCTTCTTGGTCTTCGAATCCCAAACTTTAAGTGTACTATCGCTGCTCCCACTGACCAAAAGTCTGCTGTCTGCCGACCAAGCTATCTGATAAACCGCTGACACATGGCCTCGTAAGGATGTCAAGAATTTTCCAGTTTTACCATCCCAAAGCTTGATTGATTTGTCAAAAGATGCACTAGCAATGATCCTTGTGTCAGGAGAAAAGAGAACTTCATTAATCAGGGCTTGATGTCCAGTCATCCTCTGCAAGGGCTTCTTTTCCTCTGCTGGGGCCCATAGAAACAGCGTGAAGTCATCAGAACCTGACACCAGTCTCTCAGGACCTTGGCCCCGGACTTCATTGTATCTTTTCAAGGCTTTCTCCTTCAAAACTTCCAATGAGCCACTCATGTCCTGTGGATTTACAGAAGCATCAGCTGGATTAAAAGCCCCTGTGCGGAGCACATAGTCTGTACTGAGTGCCATTGTGTTAACCCAGTGTGCATGACCTTGCAAATGTCTGCAAAGGACTCCATCCTGTGCTCTCCAGGCTTTTATTGCCCTGTCCTTGTGAGGAAGAATAAAAGGAGTTCATTCACACCCCAATTTTACTGCATTAAACTGGACTGCCTTTGGTGGCCATGTTAAGGGAACCTTTTTGAAACCCGGGCCCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCCTCCATATCCTTAGGCA