ORFeome > nrn1 ORF1 – XORFeome v1.0

nrn1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: nrn1
Gene ID: 988299
Gene Page ID: 988297
ORF Xenbase ID: 17286915

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084862
Original XGC clone length: 435

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ840042
dbEST ID: 79657744
Trimmed Sequence: ATGGGACTTAAGTTGAGCGGCAGATATATCTTTCTGGTCCTTGCTGTGCATCTAGCATACCTGCTGCAGGCGGTGAAGGCTGCAGGCAAATGTGATGCAGTGTTTAAGGGCTTATCGGACTGTATGCTCACGCTGGGCGATAAAGTGGCCAACTACCCCCAAGACCTGGAGGAAAAGAAAAATCTCGACACCATATGCTCGTACTGGGATGATTTCCACGTCTGCACTGTCACAGCCCTTGCAGATTGTCAGGAAGGGGCATCAGATATCTGGGAGAAACTGAAAAGGCAATCCAAGAACCTCAATATTCAAGGCAGCTTATTCGAACTTTGTCCTGGATCTACTGGGGCACCGGGCCCCAGGCTCCTATTTCCAGCTTTTCTGCCTTTGCTCATTGTGTTCCTCTCTGCCCTACTCAACTGGGTACTTCAGTT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGACTTAAGTTGAGCGGCAGATATATCTTTCTGGTCCTTGCTGTGCATCTAGCATACCTGCTGCAGGCGGTGAAGGCTGCAGGCAAATGTGATGCAGTGTTTAAGGGCTTATCGGACTGTATGCTCACGCTGGGCGATAAAGTGGCCAACTACCCCCAAGACCTGGAGGAAAAGAAAAATCTCGACACCATATGCTCGTACTGGGATGATTTCCACGTCTGCACTGTCACAGCCCTTGCAGATTGTCAGGAAGGGGCATCAGATATCTGGGAGAAACTGAAAAGGCAATCCAAGAACCTCAATATTCAAGGCAGCTTATTCGAACTTTGTCCTGGATCTACTGGGGCACCGGGCCCCAGGCTCCTATTTCCAGCTTTTCTGCCTTTGCTCATTGTGTTCCTCTCTGCCCTACTCAACTGGGTACTTCAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAATATCATTATTTGCCATCCAGCTGATATCCCCTATAGAGAGTCATATTACATGGTCATAGCTGTTTCCTGAAAAACAACAAACCGAGTCAAAAATCCCTGGAGGTCACAACAGGCAGGAAAAAAAGGCTGGCCTTCCGGGCCCCACAGGCTCCCGTTGTAACCCGCTGTTGGAAAGGAAAAAAAAAAAAAACACAAAAAAAAAAACAAGATCATTTCGACACGTTGTTCCAAAGACCGAGAGGGCGGCGGGGAGAAAGGGGCACCCCCTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGACTTAAGTTGAGCGGCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ840041
dbEST ID: 79657743
Trimmed Sequence: CTGAAGTACCCAGTTGAGTAGGGCAGAGAGGAACACAATGAGCAAAGGCAGAAAAGCTGGAAATAGGAGCCTGGGGCCCGGTGCCCCAGTAGATCCAGGACAAAGTTCGAATAAGCTGCCTTGAATATTGAGGTTCTTGGATTGCCTTTTCAGTTTCTCCCAGATATCTGATGCCCCTTCCTGACAATCTGCAAGGGCTGTGACAGTGCAGACGTGGAAATCATCCCAGTACGAGCATATGGTGTCGAGATTTTTCTTTTCCTCCAGGTCTTGGGGGTAGTTGGCCACTTTATCGCCCAGCGTGAGCATACAGTCCGATAAGCCCTTAAACACTGCATCACATTTGCCTGCAGCCTTCACCGCCTGCAGCAGGTATGCTAGATGCACAGCAAGGACCAGAAAGATATATCTGCCGCTCAACTTAACTCCCATGG
Full Trace Sequence: GAAACTGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGAAGTACCCAGTTGAGTAGGGCAGAGAGGAACACAATGAGCAAAGGCAGAAAAGCTGGAAATAGGAGCCTGGGGCCCGGTGCCCCAGTAGATCCAGGACAAAGTTCGAATAAGCTGCCTTGAATATTGAGGTTCTTGGATTGCCTTTTCAGTTTCTCCCAGATATCTGATGCCCCTTCCTGACAATCTGCAAGGGCTGTGACAGTGCAGACGTGGAAATCATCCCAGTACGAGCATATGGTGTCGAGATTTTTCTTTTCCTCCAGGTCTTGGGGGTAGTTGGCCACTTTATCGCCCAGCGTGAGCATACAGTCCGATAAGCCCTTAAACACTGCATCACATTTGCCTGCAGCCTTCACCGCCTGCAGCAGGTATGCTAGATGCACAGCAAGGACCAGAAAGATATATCTGCCGCTCAACTTAACTCCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCCTCAATTTGTTGCAACAAACAGGTCACTATCAGTCAAAATATATCATTATTTGGGGCCCCAGAGAAAAAAAAAAAGGACATTATAAAAACAGGGCCGCGGGGCAAGGCAGGAAAAAAAGGACGGCCTTCCGGCACCCGGGGGTTCCGTGTGGTCGTTTCTTGGGGAAAAAAGACACCCCGAACCAAAGAGAACAAACCCGGGGGCTAGGTAGAAATTTTGAGGACAAGACACCAAAGGGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGAAGTACCCAGTTGAG