ORFeome > otos ORF2 – XORFeome v1.0

otos ORF2 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: otos
Gene ID: 971583
Gene Page ID: 971578
ORF Xenbase ID: 17287653

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082909
Original XGC clone length: 270

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ839838
dbEST ID: 79657540
Trimmed Sequence: ATGAAGCTGCTTCTTATTGGATTATGTTTCTCGTGTGTTTTACTTGGCACATTTATTGATGCCAGGCCAGTGTATGGAGAGGAAGATCCATACGAGGATGCCCCTGCTCATCCTTACTGGCCCTTCTCCACTTCAGATTTCTGGCAGTATGTGGAGCATTTCCGCTCCCTGGGTGCATATGACAGGATAAATGATATGGCTCGTACCTTCTTTGCTCATTATCCTATTGGGGATACTCTTGGCTACACCAGCAGGAATGATGATGAATT
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGCTGCTTCTTATTGGATTATGTTTCTCGTGTGTTTTACTTGGCACATTTATTGATGCCAGGCCAGTGTATGGAGAGGAAGATCCATACGAGGATGCCCCTGCTCATCCTTACTGGCCCTTCTCCACTTCAGATTTCTGGCAGTATGTGGAGCATTTCCGCTCCCTGGGTGCATATGACAGGATAAATGATATGGCTCGTACCTTCTTTGCTCATTATCCTATTGGGGATACTCTTGGCTACACCAGCAGGAATGATGATGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCAAAAAAAAAAAAAAAAAATAAAACAAAAAAAAGGCCCCCCCACCAAAACAAAAAAAAAAAAAAAAACACCCACCCCCCCCCCCGCTCTGTGTGGGTGTTCGGGGGCGCGCCTAAGAGCCCCCCAGAGGAGGCGGGGGGGGGTTTTTTGGTGGAAAGGGGAAAAAGGGCCCGCCCCCCCGCGCCCTAACACCCCTTGTGGCCACAAGGGGGGGGGGGGGGGGGGGGGGGGTTGGTTTCTTTTTTATTTTTTTATTATATTTTTATAAAAACCCCCGCGGGGGAAAAACCCCCCCCTGGGGCGGTTTTTTGTTGGTTTTTTTTTTTTTCTTTTTTTTTTTTTTGTGGGTTTATCTTCCCCCTGGCCCCCGCCCGAATACAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGCTGCTTCTTATTGGATTA

Sequences - 3ʹ (reverse) EST

Accession: JZ839837
dbEST ID: 79657539
Trimmed Sequence: TTCATCATCATTCCTGCTGGTGTAGCCAAGAGTATCCCCAATAGGATAATGAGCAAAGAAGGTACGAGCCATATCATTTATCCTGTCATATGCACCCAGGGAGCGGAAATGCTCCACATACTGCCAGAAATCTGAAGTGGAGAAGGGCCAGTAAGGATGAGCAGGGGCATCCTCGTATGGATCTTCCTCTCCATACACTGGCCTGGCATCAATAAATGTGCCAAGTAAAACACACGAGAAACATAATCCAATAAGAAGCAGCTTCATGG
Full Trace Sequence: GAGAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCATCATCATTCCTGCTGGTGTAGCCAAGAGTATCCCCAATAGGATAATGAGCAAAGAAGGTACGAGCCATATCATTTATCCTGTCATATGCACCCAGGGAGCGGAAATGCTCCACATACTGCCAGAAATCTGAAGTGGAGAAGGGCCAGTAAGGATGAGCAGGGGCATCCTCGTATGGATCTTCCTCTCCATACACTGGCCTGGCATCAATAAATGTGCCAAGTAAAACACACGAGAAACATAATCCAATAAGAAGCAGCTTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACTGGCCGTCCTTTTAAAACAAAAAAAAAAAAAATAAAAAAAAAAAGGGGGCCTCCGCAACCCCCAAAAAAAAAAAAACACATCTCCCTCCCCCCCTCTTCTCTGCGGGGTGGAAAGGGGGACAAAAAAGAAAAAAACAAAAAAATCACTGAATAGGTGTTTTTTGGTTTATATATTATAGCACGGAAGAGAGCCCCCCCCCCCGCCGCCGGTACTAATAAAGAACAAAAGAAGGGGGGGGGGGGGCGGGGGGGGGGGTTTTGTGTTTTGGTTTTTATTTTATTTTTTAATTGATAATGGGGTGGCGCTAGCGAACCCCCCCGAGCGCGGCGCTCTTCTCGCCTGTGCGGTGGTTGGATTATAGATGTTGGATTAGTGAATAAAAAAAAGAAAAGGGCGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCATCATCATTCCTGCTGGT