ORFeome > paip1 ORF2 – XORFeome v1.0

paip1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: paip1
Gene ID: 866621
Gene Page ID: 855780
ORF Xenbase ID: 17287899

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123119
Original XGC clone length: 1392

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ838096
dbEST ID: 79655798
Trimmed Sequence: ATGTCCGACGGGTTTGAGAGGGCCCCTGGGGTCGGGAGGGGCAGAGGGCGCGGGCGGGGAATAGAAACGGCGGAGGGAGGGAAAACACCGGGCTTCAGTGGGGCCTCGGGCGCTGGGGATGAGCCGGGCAGAACCAAAGCCGCGGGGAGCCAACAGCAGGAGCCGCTACGGCCGCCTCGCACTGGGCCGCCTGGAGGAGGAGGAGATGCAGGAGCAGCACAGACAAGTCACAAAAGGACTTCACCAGCAGCCCAATTGCCAGCTCACACTTACACAATGGCCGTATCTAAAGCACAGCCTGCAGATCGTGGGAGACTCCTCTCAAACCTGTCTGCGAATGCTGCCGAGTTCTACCCCTCAGGATATTCTGTAGAAGCCAATAACTGTGTAGAAGAGAACGGCTGCTATCCGGTGCTTCCTGAGGGGACACTTACAGAGTATGTGCAAGACTTTTTAAACCATTTAACTGAACAACCTGGAAGTTTTGAGGCGGAAGTCTTCCCTTTCTCCGATGTACTGAATAACTGTGTTACTACAGATGAATCATTGCAAGAACTTGTTGAACTTATTTACCAGCAGGCAATATCTGTTCCAAACTTCTCTTATACGGGAGCGCGACTGTGCAATTACCTGTCAAATAATCTGCACATTAACCCCCAAAACCCGAACTTCAGGCAGTTATTGACTAAAGAGGTGTCCAACGGAATTTCCAAAAAACGAACAAGGCAACCAAAGCTGAATGGAGCGCCCCGAGAGCAATTTCCATACCCTTTTTACTGTTTCCGGGGCCG
Full Trace Sequence: GACACCAAATAATGGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCGACGGGTTTGAGAGGGCCCCTGGGGTCGGGAGGGGCAGAGGGCGCGGGCGGGGAATAGAAACGGCGGAGGGAGGGAAAACACCGGGCTTCAGTGGGGCCTCGGGCGCTGGGGATGAGCCGGGCAGAACCAAAGCCGCGGGGAGCCAACAGCAGGAGCCGCTACGGCCGCCTCGCACTGGGCCGCCTGGAGGAGGAGGAGATGCAGGAGCAGCACAGACAAGTCACAAAAGGACTTCACCAGCAGCCCAATTGCCAGCTCACACTTACACAATGGCCGTATCTAAAGCACAGCCTGCAGATCGTGGGAGACTCCTCTCAAACCTGTCTGCGAATGCTGCCGAGTTCTACCCCTCAGGATATTCTGTAGAAGCCAATAACTGTGTAGAAGAGAACGGCTGCTATCCGGTGCTTCCTGAGGGGACACTTACAGAGTATGTGCAAGACTTTTTAAACCATTTAACTGAACAACCTGGAAGTTTTGAGGCGGAAGTCTTCCCTTTCTCCGATGTACTGAATAACTGTGTTACTACAGATGAATCATTGCAAGAACTTGTTGAACTTATTTACCAGCAGGCAATATCTGTTCCAAACTTCTCTTATACGGGAGCGCGACTGTGCAATTACCTGTCAAATAATCTGCACATTAACCCCCAAAACCCGAACTTCAGGCAGTTATTGACTAAAGAGGTGTCCAACGGAATTTCCAAAAAACGAACAAGGCAACCAAAGCTGAATGGAGCGCCCCGAGAGCAATTTCCATACCCTTTTTACTGTTTCCGGGGCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGACGGGTTTGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838095
dbEST ID: 79655797
Trimmed Sequence: CTGTTTCTTCTTATGTTCTGACTCCAAGCAGAACTTCTCGTAGGCTTCTTCCATTTCAGGATCCATCTCATTATCATCATCGTCTTCAAAGTAGGAATCTCCGCCGTCTGTCCCATTTTCATCATAATCTCGGAAGAAATCTTCCCTGTCCAACAGCTCCTGGTACTTTTCTTGGTAATCGGGATCTGCTGCAGTAAAAGGGACTCCTTCAGATGTGTAAAATGTAGGTTCATTCATGAAATAGTTGGGATCATTTTCTGGCGTGGCTTCTTTGAAGGTGGAAGCAGCATGGACCCTGCCCCAGTTACTTGAACGTAGTTCCACAAGTTTCAGGAGCATCTGCTTTACATCTCTGCTACAGTTTGCATCCAATACCACATTCTTCATCCTCAGCATCACTTCTTCCATACAGGACAAAGCTTTTTCTTTCCATGCATCTTCTAAAACTGACCCAGTCAACTTCAGTAGTTTTACTGCACACATCAGGTTGTCATCCACTGGATTAGAGAACAGGGAATTCAGTAGTTCTTGGAGACCACTCTGCAGAATTTCAGCACGAGTCACTTGGCCCTTCGCTCCCTTGATCTCCAGATTGAGATAGAGCTCGCCCAGGAACAGTACAAAGGCATGAATTTGCTTTCTGGGCGCTCCTCACCCCTTTGCTGCCTGATCCCTTTTTTCAAATTTCGTTTGAAACCTCTTCAATAATAAACTGCCCGAAAATTTCCGGGTTCCGTTGGGTTAAGTGGTGCCAGATTTATTTTAACAAGG
Full Trace Sequence: CGGGAAAAGGCCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGTTTCTTCTTATGTTCTGACTCCAAGCAGAACTTCTCGTAGGCTTCTTCCATTTCAGGATCCATCTCATTATCATCATCGTCTTCAAAGTAGGAATCTCCGCCGTCTGTCCCATTTTCATCATAATCTCGGAAGAAATCTTCCCTGTCCAACAGCTCCTGGTACTTTTCTTGGTAATCGGGATCTGCTGCAGTAAAAGGGACTCCTTCAGATGTGTAAAATGTAGGTTCATTCATGAAATAGTTGGGATCATTTTCTGGCGTGGCTTCTTTGAAGGTGGAAGCAGCATGGACCCTGCCCCAGTTACTTGAACGTAGTTCCACAAGTTTCAGGAGCATCTGCTTTACATCTCTGCTACAGTTTGCATCCAATACCACATTCTTCATCCTCAGCATCACTTCTTCCATACAGGACAAAGCTTTTTCTTTCCATGCATCTTCTAAAACTGACCCAGTCAACTTCAGTAGTTTTACTGCACACATCAGGTTGTCATCCACTGGATTAGAGAACAGGGAATTCAGTAGTTCTTGGAGACCACTCTGCAGAATTTCAGCACGAGTCACTTGGCCCTTCGCTCCCTTGATCTCCAGATTGAGATAGAGCTCGCCCAGGAACAGTACAAAGGCATGAATTTGCTTTCTGGGCGCTCCTCACCCCTTTGCTGCCTGATCCCTTTTTTCAAATTTCGTTTGAAACCTCTTCAATAATAAACTGCCCGAAAATTTCCGGGTTCCGTTGGGTTAAGTGGTGCCAGATTTATTTTAACAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGTTTCTTCTTATGTTCTGACTC