ORFeome > pcgf1 ORF1 – XORFeome v1.0

pcgf1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pcgf1
Gene ID: 6255892
Gene Page ID: 6454078
ORF Xenbase ID: 17288265

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC097736
Original XGC clone length: 750

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ837139
dbEST ID: 79654841
Trimmed Sequence: ATGCGGCTCCGGAACCAGCTCCAGTCGGTTTATAAGATGGACCCACTTAGGAACGAGGAAGTGGTGAAGGTGAAAATCAAGGAGCTGAATGAGCACATCGTGTGTTACCTGTGTGCCGGCTACTTCATAGATGCCACAACCATAACGGAATGTCTGCACACCTTCTGTAAGAGCTGCATAGTGAAGTACCTACAGACCAGCAAGTACTGCCCCCTGTGCAACATCAAGATCCACGAGACTCAGCCCCTCCTCAATCTCAAGCTGGACCGGGTCATGCAGGACATTGTCTACAAGCTGGTGCCGGGCCTTCAGGAGAATGAAGACAGTCGCATCAGAGATTTCTACCATTCCCGTGGGTTGGAGCGAGTTCTTCAGCCAAGTGCAGTCGAAGACTCTGTGGGAGATGTCTCGCAGCTGTCTCTTTCCTTGGCAGTCTCTCAGAAGACGTCCCACTATTACAGGAACGATGAGCATGTCTGTCTTTGTCTTGAGAAAGTCAGTTCTGGGAAGGACAAGAAGAAGTTTATCCTACAGCAGAAATATGTGCGTTGTTCTGTCCGGTCTGAGATTCGTCACCTGCGTCGGGTTCTTAGTCATCGGCTCAGCGCACCACTGGCACAGGTGCAACTCCTGATTGATAACAAGTGCTGGCCGATCACATGACCCATAAGCAACTGTGGTTTATGCACTGGTACGGCAAGCCGGCACCGCTTGTTCTGTTTGTCCGCGTCGGGGAGAAAAAAGAAGGTTGCCAACTTTTCTTGTTACAAATTTGGGCATTAATAAAAAAAGGCATTTACTTTAGCATTTTTTTTTT
Full Trace Sequence: CGTGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCGGCTCCGGAACCAGCTCCAGTCGGTTTATAAGATGGACCCACTTAGGAACGAGGAAGTGGTGAAGGTGAAAATCAAGGAGCTGAATGAGCACATCGTGTGTTACCTGTGTGCCGGCTACTTCATAGATGCCACAACCATAACGGAATGTCTGCACACCTTCTGTAAGAGCTGCATAGTGAAGTACCTACAGACCAGCAAGTACTGCCCCCTGTGCAACATCAAGATCCACGAGACTCAGCCCCTCCTCAATCTCAAGCTGGACCGGGTCATGCAGGACATTGTCTACAAGCTGGTGCCGGGCCTTCAGGAGAATGAAGACAGTCGCATCAGAGATTTCTACCATTCCCGTGGGTTGGAGCGAGTTCTTCAGCCAAGTGCAGTCGAAGACTCTGTGGGAGATGTCTCGCAGCTGTCTCTTTCCTTGGCAGTCTCTCAGAAGACGTCCCACTATTACAGGAACGATGAGCATGTCTGTCTTTGTCTTGAGAAAGTCAGTTCTGGGAAGGACAAGAAGAAGTTTATCCTACAGCAGAAATATGTGCGTTGTTCTGTCCGGTCTGAGATTCGTCACCTGCGTCGGGTTCTTAGTCATCGGCTCAGCGCACCACTGGCACAGGTGCAACTCCTGATTGATAACAAGTGCTGGCCGATCACATGACCCATAAGCAACTGTGGTTTATGCACTGGTACGGCAAGCCGGCACCGCTTGTTCTGTTTGTCCGCGTCGGGGAGAAAAAAGAAGGTTGCCAACTTTTCTTGTTACAAATTTGGGCATTAATAAAAAAAGGCATTTACTTTAGCATTTTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGGCTCCGGAACCA

Sequences - 3ʹ (reverse) EST

Accession: JZ837138
dbEST ID: 79654840
Trimmed Sequence: CCTCCTCTTCTCCTTGACGCTGTACAACAGAACAAGCGGTGCCGGCTTGCCGTACCAGTGCATCAACCACAGCTGCTTCATGGTCATGTGATCTGGCAGCACTTTGTTATCAATCAGGAGCTGCACCTGTGCCAGTGGTGCGCTGAGCCGATGACTAAGAACCCGACGCAGGTGACGAATCTCAGACCGGACAGAACAACGCACATATTTCTGCTGTAGGATAAACTTCTTCTTGTCCTTCCCAGAACTGACTTTCTCAAGACAAAGACAGACATGCTCATCGTTCCTGTAATAGTGGGACGTCTTCTGAGAGACTGCCAAGGAAAGAGACAGCTGCGAGACATCTCCCACAGAGTCTTCGACTGCACTTGGCTGAAGAACTCGCTCCAACCCACGGGAATGGTAGAAATCTCTGATGCGACTGTCTTCACTCTCCTGAAGGCCCGGCACCAACTTGTAGACAATGTCCTGCATGACCCGGTCCAGCTTGAAATTGAGAAAGGGGCTGAGTCTCGTGGAATCTTGATGTTGCACAGGGGGGCGGGAGTTTGCTGGTCTGTAGGGTGCTTCACTATGCCAGCTCCTTACAGAAAGGTGTGCAGAGGAGTACGGTTATGGGTGGGGGGGTGGGGGAAGTTATCCTGCCACCGCGGGGAGAGGCAGAAAGTGTCCCGGTCCGGGCCCGTTGAATTTGGCCGGTCGCCGCCGTTCCGGCGGTTCCCGAAGAGTGGAGTACTGTTCTTTTGGTGCGCCAAAACTACAAAAAGAGAAATTA
Full Trace Sequence: GGGAAAATGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCTCCTCTTCTCCTTGACGCTGTACAACAGAACAAGCGGTGCCGGCTTGCCGTACCAGTGCATCAACCACAGCTGCTTCATGGTCATGTGATCTGGCAGCACTTTGTTATCAATCAGGAGCTGCACCTGTGCCAGTGGTGCGCTGAGCCGATGACTAAGAACCCGACGCAGGTGACGAATCTCAGACCGGACAGAACAACGCACATATTTCTGCTGTAGGATAAACTTCTTCTTGTCCTTCCCAGAACTGACTTTCTCAAGACAAAGACAGACATGCTCATCGTTCCTGTAATAGTGGGACGTCTTCTGAGAGACTGCCAAGGAAAGAGACAGCTGCGAGACATCTCCCACAGAGTCTTCGACTGCACTTGGCTGAAGAACTCGCTCCAACCCACGGGAATGGTAGAAATCTCTGATGCGACTGTCTTCACTCTCCTGAAGGCCCGGCACCAACTTGTAGACAATGTCCTGCATGACCCGGTCCAGCTTGAAATTGAGAAAGGGGCTGAGTCTCGTGGAATCTTGATGTTGCACAGGGGGGCGGGAGTTTGCTGGTCTGTAGGGTGCTTCACTATGCCAGCTCCTTACAGAAAGGTGTGCAGAGGAGTACGGTTATGGGTGGGGGGGTGGGGGAAGTTATCCTGCCACCGCGGGGAGAGGCAGAAAGTGTCCCGGTCCGGGCCCGTTGAATTTGGCCGGTCGCCGCCGTTCCGGCGGTTCCCGAAGAGTGGAGTACTGTTCTTTTGGTGCGCCAAAACTACAAAAAGAGAAATTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTCCTCTTCTCCTTGACGCT