ORFeome > pcnxl4 ORF2 – XORFeome v1.0

pcnxl4 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pcnxl4
Gene ID: 951153
Gene Page ID: 951149
ORF Xenbase ID: 17288343

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097920
Original XGC clone length: 765

Human orthology & disease relationships

NCBI Entrez ID: 64430
Ensembl gene IDs: ENSG00000126773
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 212065,602579,606003

Library Location

Plate ID: GDExl11089
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: JZ838421
dbEST ID: 79656123
Trimmed Sequence: ATGGCTGCCAGTATATCGGCCAATGCATCTGAGATGGGGCTCATGGCCATTGAGGACTTCCTAAGGTGCCCTCCACCTGGGATCCAGTCTCAGAATCTTTCCACCAGAAGCACCGTGACCTGCCTGTCCGACAGCATCAGCCTGATGATAGATGACTTTATCGCTATATCTGGTAGAAGGGTCATGTTTACAAACTCCCTTGGTCGAATCCTTCAGGCAAAAACTATGATGGAGTGTGCAGAGGTGAAGAAGAAACTGATGTCGAACCTCCTCATCATCCTTGTGGCTGCCTGTCAGAGTATTCCAGTTCAAGGGAAGAGAAAAAAGCCAAATAAACCAGGGAAAGTGCTAAGGCATTTTGTTCTCATGATCAATGGGAAGAATCCAAGGATTAAGTACAAAATGGAGCAAGGATTAAATGCCGTCCTGCCGTCTGTCATGTGTGAGAACTACACTGTAAAGGTTGATTTCATGGATTCTCTAGTGAAACTCACAACAGACACAGATCTCACTGTCCTTGATGGTTCTCAGTCTGTAACTCCATGCTGGAAAAACACCACCTTTTCTCTGGATTATAACGGTGATGGTGGCTGTGAGTTTGCATACTGCCTTGGGTTCAGCAAAAGGAAATTTCCAATTCAGGGTCAGATTATTCATCCTGAAAAAAAAACTGCTGAAAAAAAAGAAAAAGTGGAAGAATTCTTTTAAAC
Full Trace Sequence: CGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCCAGTATATCGGCCAATGCATCTGAGATGGGGCTCATGGCCATTGAGGACTTCCTAAGGTGCCCTCCACCTGGGATCCAGTCTCAGAATCTTTCCACCAGAAGCACCGTGACCTGCCTGTCCGACAGCATCAGCCTGATGATAGATGACTTTATCGCTATATCTGGTAGAAGGGTCATGTTTACAAACTCCCTTGGTCGAATCCTTCAGGCAAAAACTATGATGGAGTGTGCAGAGGTGAAGAAGAAACTGATGTCGAACCTCCTCATCATCCTTGTGGCTGCCTGTCAGAGTATTCCAGTTCAAGGGAAGAGAAAAAAGCCAAATAAACCAGGGAAAGTGCTAAGGCATTTTGTTCTCATGATCAATGGGAAGAATCCAAGGATTAAGTACAAAATGGAGCAAGGATTAAATGCCGTCCTGCCGTCTGTCATGTGTGAGAACTACACTGTAAAGGTTGATTTCATGGATTCTCTAGTGAAACTCACAACAGACACAGATCTCACTGTCCTTGATGGTTCTCAGTCTGTAACTCCATGCTGGAAAAACACCACCTTTTCTCTGGATTATAACGGTGATGGTGGCTGTGAGTTTGCATACTGCCTTGGGTTCAGCAAAAGGAAATTTCCAATTCAGGGTCAGATTATTCATCCTGAAAAAAAAACTGCTGAAAAAAAAGAAAAAGTGGAAGAATTCTTTTAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCCAGTAAATCGGCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838420
dbEST ID: 79656122
Trimmed Sequence: AGAAGATTGTTCCATCGCGGCATCTGACTTTATGCTGGTCTGGGGAACAAAAGCTCTAAAGAATTCTTCCACTTTCTCCTTTTCTTCAGCAGTTTTGTTTTTCAGATGAATAATCTGACCCTGAATTGGAAACTTCCTTTTGCTGAACCCAAGGCAGTATGCAAACTCACAGCCACCATCACCGTTATAATCCAGAGAAAAGGTGGTGTTTTTCCAGCATGGAGTTACAGACTGAGAACCATCAAGGACAGTGAGATCTGTGTCTGTTGTGAGTTTCACTAGAGAATCCATGAAATCAACCTTTACAGTGTAGTTCTCACACATGACAGACGGCAGGACGGCGTTTAATCCTTGCTCCATTTTGTACTTAATCCTTGGATTCTTCCCCTTGATCATGAGAACAAAATGCGTTANCACTTTCCCTGGTGTGTTTGTCTTTTTTCTCTTCCCTTGAGCTGGAATAGTCTTACAGGCAGCCGGCAAGATGATGAGGAGGTTCGAGCACAATTTCCTTCTTCGCCCCTGCGACGTGCAACAGAGGGTTGGTGCTGGGGGGATCGAGGACCGGAGGGGGTGGAGATGAACCCTTCGACCACACCTACCAAGAGAGGGGTCGAGGGGTCAGCCGTGTGGTGTCAGGGAGGAAGGAAGGGGGGGGGTGCTGGGGGGGGAAGGGTGGGAGGACGGGAACTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGC
Full Trace Sequence: GGCAAACTGCTACTGACGCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGAAGATTGTTCCATCGCGGCATCTGACTTTATGCTGGTCTGGGGAACAAAAGCTCTAAAGAATTCTTCCACTTTCTCCTTTTCTTCAGCAGTTTTGTTTTTCAGATGAATAATCTGACCCTGAATTGGAAACTTCCTTTTGCTGAACCCAAGGCAGTATGCAAACTCACAGCCACCATCACCGTTATAATCCAGAGAAAAGGTGGTGTTTTTCCAGCATGGAGTTACAGACTGAGAACCATCAAGGACAGTGAGATCTGTGTCTGTTGTGAGTTTCACTAGAGAATCCATGAAATCAACCTTTACAGTGTAGTTCTCACACATGACAGACGGCAGGACGGCGTTTAATCCTTGCTCCATTTTGTACTTAATCCTTGGATTCTTCCCCTTGATCATGAGAACAAAATGCGTTANCACTTTCCCTGGTGTGTTTGTCTTTTTTCTCTTCCCTTGAGCTGGAATAGTCTTACAGGCAGCCGGCAAGATGATGAGGAGGTTCGAGCACAATTTCCTTCTTCGCCCCTGCGACGTGCAACAGAGGGTTGGTGCTGGGGGGATCGAGGACCGGAGGGGGTGGAGATGAACCCTTCGACCACACCTACCAAGAGAGGGGTCGAGGGGTCAGCCGTGTGGTGTCAGGGAGGAAGGAAGGGGGGGGGTGCTGGGGGGGGAAGGGTGGGAGGACGGGAACTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAAGATTGTTCCATCGCGGCAT