ORFeome > psmd8 ORF1 – XORFeome v1.0

psmd8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: psmd8
Gene ID: 961860
Gene Page ID: 961853
ORF Xenbase ID: 17291427

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133237
Original XGC clone length: 816

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: C09

Sequences - 5ʹ (forward) EST

Accession: JZ840217
dbEST ID: 79657919
Trimmed Sequence: ATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAACCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGAGATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCCAAAAAATGACAGAGTATGCAAAGAACCGTGGGTTGGTTGGTGGGTCCAAACAATAACCTACGTTTTCAGTACCCAGCCGCCAAAACCCGGAAAAAAGTCCC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGAGTGGAGCTGAAGGGCTGAGGCAATTAGCTGCCATGTACGAGCAGCTGAAAACCGAATGGGCAAAGAAGAGCCCCAACCTGAGCAAATGCGGGGACGTACTTGGGAAGCTGAAGCTGGCTCTTTTGGAGCAGAACTTTTTGCCTACCACTGATGTTAAACTCACAAAGCAGCAACTAATTCTAGCTCGGGATGTTTTAGAGATTGGCGCACAGTGGAGTATACTGAAGAAAGAGATACCATCTTTTGAAAGATATATGGCCCAGCTTAAATGCTACTACTTTGACTACAAGGATGAACTACCGGAATCTGCTTATAAACACCAACTGCTGGGACTCAACCTCCTATTCCTTCTGTCACAAAACAGAGTAGCTGATTTCCACACAGAGCTGGAGAGGCTACCAGCCAAAGATATTCAAACTAATGTGTACATTAAACACCCTGTATCTCTTGAGCAGTATTTGATGGAGGGAAGCTATAACAAGGTTTTTCTGGCTAAAGGGAATATCCCAGCTGAGAGCTACACCTTCTTTATCGACATTCTGCTGGATACAATAAGGGATGAAATTGCCGATTGCATTGAAAAAGCTTATGGAAAAATCCAATTTAATGAGGCAACAAGGATATTATTCTTTACCACTCCCCAAAAAATGACAGAGTATGCAAAGAACCGTGGGTTGGTTGGTGGGTCCAAACAATAACCTACGTTTTCAGTACCCAGCCGCCAAAACCCGGAAAAAAGTCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGAGTGGAGCTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ840216
dbEST ID: 79657918
Trimmed Sequence: AACTATCATCTCTAGTTGTCGGGCATACTCGATGACTTGCTTGGCTAGCTCCGTGGATGGAATGGTGACATCTTCCGGGTTCTGCTGCTGGCTACTGAAACTGTAGTTATTGTTTGGACCCAACACCCAACCACGCTTCTTTGCATACTCTGTCATTTTCTTGGGAGTGGTAAAGAATAATATCCTTGTTGCCTCATTAAATTGGATTTTTCCATAAGCTTTTTCAATGCAATCGGCAATTTCATCCCTTATTGTATCCAGCAGAATGTCGATAAAGAAGGTGTAGCTCTCAGCTGGGATATTCCCTTTAGCCAGAAAAACCTTGTTATAGCTTCCCTCCATCAAATACTGCTCAAGAGATACAGGGTGTTTAATGTACACATTAGTTTGAATATCTTTGGCTGGTAGCCTCTCCAGCTCTGTGTGGAAATCAGCTACTCTGTTTTGTGACAGAAGGAATAGGAGGTTGAGTCCCAGCAGTTGGTGTTTATAAGCAGATTCCGGTAGTTCATCCTTGTAGTCAAAGTAGTAGCATTTAAGCTGGGCCATATATCTTTTCAAAAGATGGGATCTCTTTCTTCACTATACTCCACTGTGCGCCAATCTCTAAAACATCCCAAGCTAGAATTAATTTGCTGCCTTTTGAATTTAAAAATCATGGTTAAGCAAAAAATTTCCTCCTCCCAAAAACCCGGCTTCCACCTTCCCCAGTAACTTCCCCCGCATTTTGGCCA
Full Trace Sequence: CGGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACTATCATCTCTAGTTGTCGGGCATACTCGATGACTTGCTTGGCTAGCTCCGTGGATGGAATGGTGACATCTTCCGGGTTCTGCTGCTGGCTACTGAAACTGTAGTTATTGTTTGGACCCAACACCCAACCACGCTTCTTTGCATACTCTGTCATTTTCTTGGGAGTGGTAAAGAATAATATCCTTGTTGCCTCATTAAATTGGATTTTTCCATAAGCTTTTTCAATGCAATCGGCAATTTCATCCCTTATTGTATCCAGCAGAATGTCGATAAAGAAGGTGTAGCTCTCAGCTGGGATATTCCCTTTAGCCAGAAAAACCTTGTTATAGCTTCCCTCCATCAAATACTGCTCAAGAGATACAGGGTGTTTAATGTACACATTAGTTTGAATATCTTTGGCTGGTAGCCTCTCCAGCTCTGTGTGGAAATCAGCTACTCTGTTTTGTGACAGAAGGAATAGGAGGTTGAGTCCCAGCAGTTGGTGTTTATAAGCAGATTCCGGTAGTTCATCCTTGTAGTCAAAGTAGTAGCATTTAAGCTGGGCCATATATCTTTTCAAAAGATGGGATCTCTTTCTTCACTATACTCCACTGTGCGCCAATCTCTAAAACATCCCAAGCTAGAATTAATTTGCTGCCTTTTGAATTTAAAAATCATGGTTAAGCAAAAAATTTCCTCCTCCCAAAAACCCGGCTTCCACCTTCCCCAGTAACTTCCCCCGCATTTTGGCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACTATCATCTCTAGTTGTCGG