ORFeome > rad51ap1 ORF1 – XORFeome v1.0

rad51ap1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rad51ap1
Gene ID: 963256
Gene Page ID: 963251
ORF Xenbase ID: 17292399

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110928
Original XGC clone length: 951

Human orthology & disease relationships

NCBI Entrez ID: 10635
Ensembl gene IDs: ENSG00000111247
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,118400,604391

Library Location

Plate ID: GDExl11085
Well Location: F09

Sequences - 5ʹ (forward) EST

Accession: JZ837725
dbEST ID: 79655427
Trimmed Sequence: ATGGCAAGGAATAAGAAAGCTGTGGATTATTCACAATTTGGAGACTTGGATAATGATGATGAGGATTTTGCTTTCTCTTCTGCACCTCCAAGCAAAAAGCCTCGGGTGGAGAGCAAGAAAGAGAAAAAGGAGAAACCAGTAAAAAAGTCTAATAAAGAAGAAAATTTGTTCCAGCAGACATCCCCAGGGAAAAGGCTTCCCCTTGATGAAAAGCTATACGAGAGGGATTTAGAAGTGGCTCTGGCCCTTTCTGTACAGAAGACTACAGCCATTGTAGAAAGCAGAGAGGAGAATGGAGTGGCAACATTCACTGATGAAACGAACGAGAGGGCTGATAATTCATTCTCAAACTGTAGTGTAGACAGCAGTACTTTAGGCCTGGATGAAATCACCAGTGGTAACGAAGATCAACTCAATGGGCGAAATCGTAGACAAGCTGCGTCCAAAGCCATCTTCGAGCAGCGCAAGCTTTTGGCAGATGACAGTGATCATGATGAAGTAGGAGATGAGTTTAAACCTGATGTTGCTTATGATGAATCAGAAAGTGAAGAAGACTTCAGTGGGGAAGATGAAGAGTTTGATTTTAAAAACACCAAAAAATCCAAAGCAAATAAAGGGCACTAAACAAAGGGCCAAGAACGCAAAGAAAAGAAAAAAACCCCCCCCAAGCCCCAAATTTAAAGCATAACCCTGTATTCTCTTCCGGTGCCCGCTTGGGGGCAAAATCCCCGCCCAACAAAAAAAAAAAACAAAACCCCCCTTCCCCACC
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAAGGAATAAGAAAGCTGTGGATTATTCACAATTTGGAGACTTGGATAATGATGATGAGGATTTTGCTTTCTCTTCTGCACCTCCAAGCAAAAAGCCTCGGGTGGAGAGCAAGAAAGAGAAAAAGGAGAAACCAGTAAAAAAGTCTAATAAAGAAGAAAATTTGTTCCAGCAGACATCCCCAGGGAAAAGGCTTCCCCTTGATGAAAAGCTATACGAGAGGGATTTAGAAGTGGCTCTGGCCCTTTCTGTACAGAAGACTACAGCCATTGTAGAAAGCAGAGAGGAGAATGGAGTGGCAACATTCACTGATGAAACGAACGAGAGGGCTGATAATTCATTCTCAAACTGTAGTGTAGACAGCAGTACTTTAGGCCTGGATGAAATCACCAGTGGTAACGAAGATCAACTCAATGGGCGAAATCGTAGACAAGCTGCGTCCAAAGCCATCTTCGAGCAGCGCAAGCTTTTGGCAGATGACAGTGATCATGATGAAGTAGGAGATGAGTTTAAACCTGATGTTGCTTATGATGAATCAGAAAGTGAAGAAGACTTCAGTGGGGAAGATGAAGAGTTTGATTTTAAAAACACCAAAAAATCCAAAGCAAATAAAGGGCACTAAACAAAGGGCCAAGAACGCAAAGAAAAGAAAAAAACCCCCCCCAAGCCCCAAATTTAAAGCATAACCCTGTATTCTCTTCCGGTGCCCGCTTGGGGGCAAAATCCCCGCCCAACAAAAAAAAAAAACAAAACCCCCCTTCCCCACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAAGGAATAAGAAAGCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837724
dbEST ID: 79655426
Trimmed Sequence: ATGTTTGACAACAGCTGGGTGTAAAGGCTTGATCCGCGCCAATCTTGAGAGTCCCAGTCGCAGACCTTGGCTAGGAGACTTTACGGTGACTCCTCCCAGTGAGTGTTTAACACTTCCTACAGTAGCTGGTGGTGACCATGTAGGTTTCTTCATCCCCACTGAGGGACTATGATGTATGGCTTGTTTTACAGGAGCTGGTGACGGGGTTGGTGTTTTCTTTGCTGGCAGAGATTTTGCTTTAGTGGGCACAGGAGAGGATACAGGATATGCGTTAATTTTGGGCTTGGGGAGGCTTTTCTCTTTCTTTTCGCTCTTGGCCTTTTGTTTAGTGCCTTTATTTGCTTTGGATTTTTTGGTGTTTTTTAAATCAAACTCTTCATCTTCCCCGCTGAAGTCTTCTTCACTTTCTGATTCATCATAATCAACATCAAGTTTAGACTCATCTCCTACTTCATCATGATCACTCTCAGCGGCCAGAAACTAGCGCTGCTCAAAGAGAACATTGTACGGGGCTTAACTAGAAAATTCTCCATCGAATTGATCTTACTTACCACCCGTGGAGGGTGCCACGCCGAGGGTACGTGAGTGGGACACTACAAATTGGAAGGAGTTAACAACCCTCTCGCTCCTTTGAGCGTCGCATGAGGGCAGGCCATTCTCCTCTCTCCTTCCTACATTAAAAGGGGCTTCTCTCCGAAAGGGGGGGAGGCACGAGAAAATCCTTCTCGTCTGGTTGTGGGCAAAAACAAGGGGAGCAATACCAGGGGGGGGGGGGGGGAGGAACAATTTGTGCAACAAGAGGCGAGTTGGGGGGTGGGCGGTCGGTCCCGCCCCCCCGCCAGCTGGTGGGGGTCGGGGGGGGGGGGGAGAAAAAAAAAAGCAGGCGCGCGGGGCACATATTCTGGGAGAGGAAAAAGCAATATAACCCTTGGGCGGGGGGAGGGGGGGTGGGTCGGGTGGTGTGGAGGGGAGGTGGGGAAAAAAAAAAAAAATAAAAAAAAGAAAAAAAAGGAAGAACAAGAGAAGAAAGACAAAAAAAAAAAACACACGACCCAGAAAAGGGAGAAGGAGGGGGAGGGGNGGCGAGGGGAGAAGGAAGAGAGTAAGTNGAAGGGGAGANAGANAGAGGANGGGGCGNNGNGA
Full Trace Sequence: GGGCAGGGAACAGCCACTGAACAAAGTAAAACGACTAACTAGACGGGGAAGAAAGCCAGGAGGGCAATAATGATTATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGTTTGACAACAGCTGGGTGTAAAGGCTTGATCCGCGCCAATCTTGAGAGTCCCAGTCGCAGACCTTGGCTAGGAGACTTTACGGTGACTCCTCCCAGTGAGTGTTTAACACTTCCTACAGTAGCTGGTGGTGACCATGTAGGTTTCTTCATCCCCACTGAGGGACTATGATGTATGGCTTGTTTTACAGGAGCTGGTGACGGGGTTGGTGTTTTCTTTGCTGGCAGAGATTTTGCTTTAGTGGGCACAGGAGAGGATACAGGATATGCGTTAATTTTGGGCTTGGGGAGGCTTTTCTCTTTCTTTTCGCTCTTGGCCTTTTGTTTAGTGCCTTTATTTGCTTTGGATTTTTTGGTGTTTTTTAAATCAAACTCTTCATCTTCCCCGCTGAAGTCTTCTTCACTTTCTGATTCATCATAATCAACATCAAGTTTAGACTCATCTCCTACTTCATCATGATCACTCTCAGCGGCCAGAAACTAGCGCTGCTCAAAGAGAACATTGTACGGGGCTTAACTAGAAAATTCTCCATCGAATTGATCTTACTTACCACCCGTGGAGGGTGCCACGCCGAGGGTACGTGAGTGGGACACTACAAATTGGAAGGAGTTAACAACCCTCTCGCTCCTTTGAGCGTCGCATGAGGGCAGGCCATTCTCCTCTCTCCTTCCTACATTAAAAGGGGCTTCTCTCCGAAAGGGGGGGAGGCACGAGAAAATCCTTCTCGTCTGGTTGTGGGCAAAAACAAGGGGAGCAATACCAGGGGGGGGGGGGGGGAGGAACAATTTGTGCAACAAGAGGCGAGTTGGGGGGTGGGCGGTCGGTCCCGCCCCCCCGCCAGCTGGTGGGGGTCGGGGGGGGGGGGGAGAAAAAAAAAAGCAGGCGCGCGGGGCACATATTCTGGGAGAGGAAAAAGCAATATAACCCTTGGGCGGGGGGAGGGGGGGTGGGTCGGGTGGTGTGGAGGGGAGGTGGGGAAAAAAAAAAAAAATAAAAAAAAGAAAAAAAAGGAAGAACAAGAGAAGAAAGACAAAAAAAAAAAACACACGACCCAGAAAAGGGAGAAGGAGGGGGAGGGGNGGCGAGGGGAGAAGGAAGAGAGTAAGTNGAAGGGGAGANAGANAGAGGANGGGGCGNNGNGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGTTTGACAACAGCTGGG