ORFeome > rnf220.1 ORF1 – XORFeome v1.0

rnf220.1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rnf220.1
Gene ID: 865514
Gene Page ID: 485088
ORF Xenbase ID: 17293827

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124879
Original XGC clone length: 906

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ838253
dbEST ID: 79655955
Trimmed Sequence: ATGCAGAGCGAAACCAGGTCTCCAGGCAGAGAGGAAACCTTTCTGAGAGTGAGAGCCAATAGACAAACCAGACTTAATGCTCGGATTGGAAAAATGAAACGAAGGAAGCAAGATGACGGGCAGGTATGTCCACTATGCAGTCAGCCACTCTCTGGATCGGAGGAGGAGATGAGTAGACATGTGGAACTGTGCCTTGCTAAGAGAGAAACCTGCATGAATGAGGATGATTCTGTTGATATTGAGAATGAGAATGGAAACAGATTTGAGGAATATGAATGGTGTGGACAGAAAAGGATACGAGCCACAACACTTCTGGAAGGGGGATTTCGTGGTTCTGGGTTTGTTATGTGTGGCAGCAAAGAAAACCATGATAGTGATGCTGATTTAGATGTTGATGGGGACGACACTCTGGAATATGGAAAGGCGCAATATACAGAAGCAGATATTATTCCATGTACAGGAGAGGAACCTGGAGAAGCCAAAGAAAGAGAAGCTCTTCGAGGAGCAGTTTTAAATGGTGGAACACCAAGCACCAGGATAACGACCGAATTCTCTAAATGGGCGAGTGATGAAGTGCCATCAACAAGTAACGGCGAGAGTAGTAAACAGGAAACAATGCCCAAAACATGCAAAAACAGTGAAATTGAAAGAATACAAAAGAATCTGGATTCACACCGTTTGAAACATTAAAGCACGTATTCTTTAATTTAAAAAAAAAGTTTCTCCCAAGGGAAACCCTAAGGGTGGCCCCCTTTTGCGTGGATTTCCCAAAAAAAGGGGCCCCCGAAAACCTAAATCCCATGGCCTGCCCTTTTTTTCCCTGG
Full Trace Sequence: CGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGAGCGAAACCAGGTCTCCAGGCAGAGAGGAAACCTTTCTGAGAGTGAGAGCCAATAGACAAACCAGACTTAATGCTCGGATTGGAAAAATGAAACGAAGGAAGCAAGATGACGGGCAGGTATGTCCACTATGCAGTCAGCCACTCTCTGGATCGGAGGAGGAGATGAGTAGACATGTGGAACTGTGCCTTGCTAAGAGAGAAACCTGCATGAATGAGGATGATTCTGTTGATATTGAGAATGAGAATGGAAACAGATTTGAGGAATATGAATGGTGTGGACAGAAAAGGATACGAGCCACAACACTTCTGGAAGGGGGATTTCGTGGTTCTGGGTTTGTTATGTGTGGCAGCAAAGAAAACCATGATAGTGATGCTGATTTAGATGTTGATGGGGACGACACTCTGGAATATGGAAAGGCGCAATATACAGAAGCAGATATTATTCCATGTACAGGAGAGGAACCTGGAGAAGCCAAAGAAAGAGAAGCTCTTCGAGGAGCAGTTTTAAATGGTGGAACACCAAGCACCAGGATAACGACCGAATTCTCTAAATGGGCGAGTGATGAAGTGCCATCAACAAGTAACGGCGAGAGTAGTAAACAGGAAACAATGCCCAAAACATGCAAAAACAGTGAAATTGAAAGAATACAAAAGAATCTGGATTCACACCGTTTGAAACATTAAAGCACGTATTCTTTAATTTAAAAAAAAAGTTTCTCCCAAGGGAAACCCTAAGGGTGGCCCCCTTTTGCGTGGATTTCCCAAAAAAAGGGGCCCCCGAAAACCTAAATCCCATGGCCTGCCCTTTTTTTCCCTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGAGCGAAACCAGGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838252
dbEST ID: 79655954
Trimmed Sequence: CAAGTACACACGTCTCAAGTCTCCAGGTGATGTGATGGTATTACACTGTGGGCAGAGCTTCTTAGCGCCCAGAGTGCGCAGCCAGCATTCTTCACAGTGAACATGCCAGCACTGAATAGATGTCAGGGGCATTGTGTAGGAATCCATGCAAATGAGGCATTTGTAGCGGTCCCCTCGGGAGAGCTGTCTTTCTAACTCACGGATACGTGCTTTTAGTGCTTCAAACGTTGTGACTGCAGATTCTTCTGTGATCTTTTCAATTTCACTGTTTTTGCATGTTTTCTGCATTGTTTCCTGTTTACTACTCTCGCCGTTACTTGTTGATGGCATTTCATCACTCGCCCATTTATAGAATTCGGTCGTTATCCTGGTGCTTGGTGTTCCACCATTTAAAACTGCTCCTCGAAGAACTTCTCTTTCTTTGTCTTCTCCAGGTTCCTCTCCTGTACATGGAAGAGTAACTGCTTCTGGTAATTGCGCCTTTCCATATTCCAGAGTGTCGGCGCCATCCACATCTAAATCAGCATCACTATCATGGTTTTCGTTTCTGGCAGGCATAACAAACCAAAAACCACAAATCCCACATTCCAAAGTGGTGGTGGGTGGAATCGAATTTCTGTCCCGACCGGTCCAAATCCTTAAAAACGGTTTTCCTTTCTCGTTTCTCGATAATAAAAAAAAAAAAAACCACAAATAATAGCAAGTTTTCCTCGTTTGTCTAAATGCCAAAATTGGCCCGGGGTCGTACCCCACCCCCCCTCGGTCCGAATCCAAAAAAAC
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAGTACACACGTCTCAAGTCTCCAGGTGATGTGATGGTATTACACTGTGGGCAGAGCTTCTTAGCGCCCAGAGTGCGCAGCCAGCATTCTTCACAGTGAACATGCCAGCACTGAATAGATGTCAGGGGCATTGTGTAGGAATCCATGCAAATGAGGCATTTGTAGCGGTCCCCTCGGGAGAGCTGTCTTTCTAACTCACGGATACGTGCTTTTAGTGCTTCAAACGTTGTGACTGCAGATTCTTCTGTGATCTTTTCAATTTCACTGTTTTTGCATGTTTTCTGCATTGTTTCCTGTTTACTACTCTCGCCGTTACTTGTTGATGGCATTTCATCACTCGCCCATTTATAGAATTCGGTCGTTATCCTGGTGCTTGGTGTTCCACCATTTAAAACTGCTCCTCGAAGAACTTCTCTTTCTTTGTCTTCTCCAGGTTCCTCTCCTGTACATGGAAGAGTAACTGCTTCTGGTAATTGCGCCTTTCCATATTCCAGAGTGTCGGCGCCATCCACATCTAAATCAGCATCACTATCATGGTTTTCGTTTCTGGCAGGCATAACAAACCAAAAACCACAAATCCCACATTCCAAAGTGGTGGTGGGTGGAATCGAATTTCTGTCCCGACCGGTCCAAATCCTTAAAAACGGTTTTCCTTTCTCGTTTCTCGATAATAAAAAAAAAAAAAACCACAAATAATAGCAAGTTTTCCTCGTTTGTCTAAATGCCAAAATTGGCCCGGGGTCGTACCCCACCCCCCCTCGGTCCGAATCCAAAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAGTACACACGTCTCAAGTC