ORFeome > rpl32 ORF1 – XORFeome v1.0

rpl32 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rpl32
Gene ID: 948163
Gene Page ID: 948154
ORF Xenbase ID: 17294277

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078535
Original XGC clone length: 408

Human orthology & disease relationships

NCBI Entrez ID: 6161
Ensembl gene IDs: ENSG00000144713
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603896

Library Location

Plate ID: GDExl11004
Well Location: F05

Sequences - 5ʹ (forward) EST

Accession: JZ839753
dbEST ID: 79657455
Trimmed Sequence: ATGGCGGCCCTCAGACCTCTCACCAAGCCAAAGATAGTGAAGAAGCGGACAAAAAAGTTCATCCGCCACCAGTCAGATCGCTATGTTAAGATTAAGCGTAACTGGCGCAAACCCAGAGGTATTGATAACAGAGCCCGCAGAAGGTTTAAGGGACAGATCCTGATGCCTAACATTGGTTATGGTAGCAACAAAAAGACAAAACACATGTTGCCCACAGGATTTAAGAAGTTTCTGGTGCACAACATCAAAGAATTGGAGGTTCTCATGATGAGCAACAAGTCTTTCTGCGCAGAAATCGCCCACAATGTTTCCTCTAAAAACCGTAAGACAATTGTGGAGAGAGCTGCACAGCTTGCAATCAAAGTCACAAACCCCAACGCCAGACTTCGCAGCGAGGAAAACGAATT
Full Trace Sequence: GCTCTGTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCCCTCAGACCTCTCACCAAGCCAAAGATAGTGAAGAAGCGGACAAAAAAGTTCATCCGCCACCAGTCAGATCGCTATGTTAAGATTAAGCGTAACTGGCGCAAACCCAGAGGTATTGATAACAGAGCCCGCAGAAGGTTTAAGGGACAGATCCTGATGCCTAACATTGGTTATGGTAGCAACAAAAAGACAAAACACATGTTGCCCACAGGATTTAAGAAGTTTCTGGTGCACAACATCAAAGAATTGGAGGTTCTCATGATGAGCAACAAGTCTTTCTGCGCAGAAATCGCCCACAATGTTTCCTCTAAAAACCGTAAGACAATTGTGGAGAGAGCTGCACAGCTTGCAATCAAAGTCACAAACCCCAACGCCAGACTTCGCAGCGAGGAAAACGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGAAAGCTCTGGACCGTGTCTCAAATCTAAAGATGTAACATGGCGGAGGGAGGGGGGCATCAGCTCGTGACGTCCCCTCGGCAACCGGGGCGGAACCTGGAAAAAAAGAAAGAGGAAAAAAATACTGCATATGGGTATTTCGCCCATGGACGAATAACGCAAAGGGAGAGAAGAACCCGCCGCATGGGGCCTCCCTTCGCCTCGCAAAAGGGGGGTGGGTGGGCGGCGGGGGGTTTCCTACGCATGTTGTGAATTTTTTGTAGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCCCTCAGACCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839752
dbEST ID: 79657454
Trimmed Sequence: TTCGTTTTCCTCGCTGCGAAGTCTGGCGTTGGGGTTTGTGACTTTGATTGCAAGCTGTGCAGCTCTCTCCACAATTGTCTTACGGTTTTTAGAGGAAACATTGTGGGCGATTTCTGCGCAGAAAGACTTGTTGCTCATCATGAGAACCTCCAATTCTTTGATGTTGTGCACCAGAAACTTCTTAAATCCTGTGGGCAACATGTGTTTTGTCTTTTTGTTGCTACCATAACCAATGTTAGGCATCAGGATCTGTCCCTTAAACCTTCTGCGGGCTCTGTTATCAATACCTCTGGGTTTGCGCCAGTTACGCTTAATCTTAACATAGCGATCTGACTGGTGGCGGATGAACTTTTTTGTCCGCTTCTTCACTATCTTTGGCTTGGTGAGAGGTCTGAGGGCCGCCATGG
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCGTTTTCCTCGCTGCGAAGTCTGGCGTTGGGGTTTGTGACTTTGATTGCAAGCTGTGCAGCTCTCTCCACAATTGTCTTACGGTTTTTAGAGGAAACATTGTGGGCGATTTCTGCGCAGAAAGACTTGTTGCTCATCATGAGAACCTCCAATTCTTTGATGTTGTGCACCAGAAACTTCTTAAATCCTGTGGGCAACATGTGTTTTGTCTTTTTGTTGCTACCATAACCAATGTTAGGCATCAGGATCTGTCCCTTAAACCTTCTGCGGGCTCTGTTATCAATACCTCTGGGTTTGCGCCAGTTACGCTTAATCTTAACATAGCGATCTGACTGGTGGCGGATGAACTTTTTTGTCCGCTTCTTCACTATCTTTGGCTTGGTGAGAGGTCTGAGGGCCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGACTGAGCTTAAAAAAGAACGACTTTCTTTCACTCGAATGATGGGGAGGCAGGGGATGATAGCCTCAAGGGTCCCATGGGGGAATGGGGCCGAAAATGAACATTAGTAAAAGGGGGAACCCTCGCCAAAAAGCTATTCGCCCCGGGACGGAATGGGAGGGGGGTAGGACAACCCAAGGGGGGGGAAGCCTTGGCGCAGGGCGGGGGGGAAGGGGGCCGATGGGGATTTTCGATTGTGGAGTGTTCGTTTTTTTGTGGTGGGAGCTAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCGTTTTCCTCGCTGCGAAGT