ORFeome > rps28p9 ORF1 – XORFeome v1.0

rps28p9 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: rps28p9
Gene ID: 1006620
Gene Page ID: 1006613
ORF Xenbase ID: 17294631

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078605
Original XGC clone length: 210

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ839745
dbEST ID: 79657447
Trimmed Sequence: ATGGAAGCCAGCCGCGTGCAGCCGATCAAGCTTGCCCGGGTAACAAAAGTCTTGGGGCGCACAGGTTCTCAGGGTCAGTGTACCCAGGTCCGTGTTGAGTTCATGGATGACAGCAACCGTTCCATCATTCGTAATGTTAAGGGACCAGTTAGAGAGGGGGATGTCCTGACTCTGCTGGAATCTGAGCGAGAAGCTAGAAGATTACGTTT
Full Trace Sequence: TGCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGCCAGCCGCGTGCAGCCGATCAAGCTTGCCCGGGTAACAAAAGTCTTGGGGCGCACAGGTTCTCAGGGTCAGTGTACCCAGGTCCGTGTTGAGTTCATGGATGACAGCAACCGTTCCATCATTCGTAATGTTAAGGGACCAGTTAGAGAGGGGGATGTCCTGACTCTGCTGGAATCTGAGCGAGAAGCTAGAAGATTACGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCATAAAATCACAGAAAAAACAACACCATGGCAACTTACACAAGCAAGAAATAAAAGCATGGCTCCTCTGCAACACCGGGTACCCAGTTGCCTCATCTTCGTAAGCGAAGAAGGGCTAACCGGGAGAAACAACCGGGGAAAGATTGGAAAGTGGAAAAAAAAAACGGAAAGGGGCCCCGGCCGGGTCCAAAACCTGAAAAAAACAAAGGGGGAAAGCGGCCCAGGGGGGGTGTTCAGGATGGTTTGAACGGATTTTTGGGGGGGTATTTGGGCCCCGGGGCACCTTTCCCAAGGCCGGTTTCACCGGGGGGTTTTTTTGGGGTTAATGTCCCCAACCCCCCGGGCCCCCACGGGGCCCCCCCCCCCAAAAACCCCCCCTTTGTAGAAAGAGTATTGTGAAGGTCAGAAAAAAACACCCCAAACAACAAAAAAAGAAGGGCGCGGCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGCCAGCCGCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839744
dbEST ID: 79657446
Trimmed Sequence: ACGTAATCTTCTAGCTTCTCGCTCAGATTCCAGCAGAGTCAGGACATCCCCCTCTCTAACTGGTCCCTTAACATTACGAATGATGGAACGGTTGCTGTCATCCATGAACTCAACACGGACCTGGGTACACTGACCCTGAGAACCTGTGCGCCCCAAGACTTTTGTTACCCGGGCAAGCTTGATCGGCTGCACGCGGCTGGCTTCCATGG
Full Trace Sequence: AAAATGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACGTAATCTTCTAGCTTCTCGCTCAGATTCCAGCAGAGTCAGGACATCCCCCTCTCTAACTGGTCCCTTAACATTACGAATGATGGAACGGTTGCTGTCATCCATGAACTCAACACGGACCTGGGTACACTGACCCTGAGAACCTGTGCGCCCCAAGACTTTTGTTACCCGGGCAAGCTTGATCGGCTGCACGCGGCTGGCTTCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGGCCGTCGTGATAGAACATAAGGACTGATATCATCATGGCAACGCATTGCCCGGCAGAAATAAAGGCAAGGGTCCGACGGAACCCTGGGGCGCCGGGTGCTCTCTGGTGGGCGGGGAAGGGGGGCCCAATCGGAGGAATCAGGCGGGGTCGGGTCGAAGCGTGGAAGGAAAAAAACAAAGCGCTCCAGCACCGGGTCAAAACCTTTAGCAAACACACGCGGGGTAAGGGGGGGTGGGGGGTTTCCTGGGTGGGATAAATTGTTTTTGGGGGGTAGATCTAGGGCGGGGGCATCCCCCNCCCAGGCGCGTACCGCGTGGGCTGGGGGTTGGGTGTTGGGAGAGCGAACTAATGTAACCCANAAGGGCGTCCTCCCCAAAAAAAATACAATATATAAGAAGAAGGAGGTATGGGGCGGGAGGAGTGACGGACANTCAATAAGAAGGAAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGTAATCTTCTAGCTTCTCGCTC