ORFeome > rps3a ORF2 – XORFeome v1.0

rps3a ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: rps3a
Gene ID: 6253799
Gene Page ID: 976730
ORF Xenbase ID: 17294667

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC153786
Original XGC clone length: 795

Human orthology & disease relationships

NCBI Entrez ID: 6189
Ensembl gene IDs: ENSG00000145425
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,180105,182290,219500,259500,300367,400042,600652,603278,603896,607841

Library Location

Plate ID: GDExl11092
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ839030
dbEST ID: 79656732
Trimmed Sequence: ATGGCAGTGGGCAAGAACAAGAGGCTGACTAAAGGCGGCAAGAAGGGTGCCAAAAAGAAGATTGTGGACCCCTTCTCCAAAAAGGATTGGTATGATGTCAAGGCCCCTGCAATGTTCAATATCCGCAACCTCGGAAAGACTCTTGTCACCAGAACACAAGGAACCAAAATTGCCTCTGATGGGCTGAAGGGTCGCGTCTTTGAAGTGAGCTTGGCTGATCTGCAAAACGACGAAGTGGCTTTCCGTAAATTCAAGCTGATTACAGAAGATGTTCAGGGCAAGAACTGCTTGACTAACTTCCACGGCATGGATCTCACTCGTGATAAAATGTGCTCCATGGTCAAGAAATGGCAGACCATGATTGAAGCCCATGTTGATGTGAAGACCACAGATGGCTACCTGCTCCGTCTCTTCTGTGTCGGATTCACTAAGAAGCGGAACAATCAGATCAGGAAGACTTCCTATGCTCAACACCAGCAGGTCCGCCAAATTCGCAAGAAGATGATGGAAATTATGAGCCGTGAAGTGCAAACCAATGACCTAAAGGAAGTTGTCAATAAACTGATTCCAGACAGTATAGGCNAAGATATTGAAAAGGCCTGCCAGTCAATTTATCCTCTCCATGATGTCTATGCCCGCAAAGTGAAGATGCTAAAGAAGCCAAAGTTTGAGCTGGGCAAACTCATGGAACTTCATGGCGGAGGGTTGAAAGTATTGGAAAACCAGCACCAAAATAGACTGGGTGCTAAAGTGGAAACGTTCCGAATGGGTATTAAACCCCCCGGTGCCAAGAAATCCGTCCTTGCCAACTTTTTCCTTTA
Full Trace Sequence: CCGTGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGTGGGCAAGAACAAGAGGCTGACTAAAGGCGGCAAGAAGGGTGCCAAAAAGAAGATTGTGGACCCCTTCTCCAAAAAGGATTGGTATGATGTCAAGGCCCCTGCAATGTTCAATATCCGCAACCTCGGAAAGACTCTTGTCACCAGAACACAAGGAACCAAAATTGCCTCTGATGGGCTGAAGGGTCGCGTCTTTGAAGTGAGCTTGGCTGATCTGCAAAACGACGAAGTGGCTTTCCGTAAATTCAAGCTGATTACAGAAGATGTTCAGGGCAAGAACTGCTTGACTAACTTCCACGGCATGGATCTCACTCGTGATAAAATGTGCTCCATGGTCAAGAAATGGCAGACCATGATTGAAGCCCATGTTGATGTGAAGACCACAGATGGCTACCTGCTCCGTCTCTTCTGTGTCGGATTCACTAAGAAGCGGAACAATCAGATCAGGAAGACTTCCTATGCTCAACACCAGCAGGTCCGCCAAATTCGCAAGAAGATGATGGAAATTATGAGCCGTGAAGTGCAAACCAATGACCTAAAGGAAGTTGTCAATAAACTGATTCCAGACAGTATAGGCNAAGATATTGAAAAGGCCTGCCAGTCAATTTATCCTCTCCATGATGTCTATGCCCGCAAAGTGAAGATGCTAAAGAAGCCAAAGTTTGAGCTGGGCAAACTCATGGAACTTCATGGCGGAGGGTTGAAAGTATTGGAAAACCAGCACCAAAATAGACTGGGTGCTAAAGTGGAAACGTTCCGAATGGGTATTAAACCCCCCGGTGCCAAGAAATCCGTCCTTGCCAACTTTTTCCTTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGTGGGCAAGAACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839029
dbEST ID: 79656731
Trimmed Sequence: GACGGATTCCTGCACTGGGGGTTCATACCCATCAGCACGTTCCACTTTAGCACCAGTCTCATCTGCTGCTGGTTTTCCACTACCTCCACCCTCGCCATGAAGTTCCATGAGTTTGCCCAGCTCAAACTTTGGCTTCTTTAGCATCTTCACTTTGCGGGCATAGACATCATGGAGAGGATAAATTGACTGGCAGGCCTTTTCAATATCTTTGCCTATACTGTCTGGAATCAGTTTATTGACAACTTCCTTTAGGTCATTGGTTTGCACTTCACGGCTCATAATTTCCATCATCTTCTTGCGAATTTGGCGGACCTGCTGGTGTTGAGCATAGGAAGTCTTCCTGATCTGATTGTTCCGCTTCTTAGTGAATCCGACACAGAAGAGACGGAGCAGGTAGCCATCTGTGGTCTTCACATCAACATGGGCTTCAATCATGGTCTGCCATTTCTTGACCATGGAGCACATTTTATCACGAGTGAAATCCATGCCGTGGAAGTTAATCCAGCAGTTCTTGCCCTGAACATCCTCTGTAATCACCTTGAATTTACGGAAAGCCCCTTCCTCCTTTTGCCAATCCACCCAACCTCCTTTCAAAAACCCAACCTTTCACCCCATCAAAGGCAATTTTGGTTTCCTTGTGTTTTGGGGAAAAGAGGCCTTTCCAAAGGTTCCGGAAAAATGGAAATTGGACAGGGGCCTTTGACGTCGAAGACCATTCCTTTTTTGGAAAAAAGGGGGGCCCACAGAGCCTTCTTTTGTTGTGGGCC
Full Trace Sequence: GGGAATATGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACGGATTCCTGCACTGGGGGTTCATACCCATCAGCACGTTCCACTTTAGCACCAGTCTCATCTGCTGCTGGTTTTCCACTACCTCCACCCTCGCCATGAAGTTCCATGAGTTTGCCCAGCTCAAACTTTGGCTTCTTTAGCATCTTCACTTTGCGGGCATAGACATCATGGAGAGGATAAATTGACTGGCAGGCCTTTTCAATATCTTTGCCTATACTGTCTGGAATCAGTTTATTGACAACTTCCTTTAGGTCATTGGTTTGCACTTCACGGCTCATAATTTCCATCATCTTCTTGCGAATTTGGCGGACCTGCTGGTGTTGAGCATAGGAAGTCTTCCTGATCTGATTGTTCCGCTTCTTAGTGAATCCGACACAGAAGAGACGGAGCAGGTAGCCATCTGTGGTCTTCACATCAACATGGGCTTCAATCATGGTCTGCCATTTCTTGACCATGGAGCACATTTTATCACGAGTGAAATCCATGCCGTGGAAGTTAATCCAGCAGTTCTTGCCCTGAACATCCTCTGTAATCACCTTGAATTTACGGAAAGCCCCTTCCTCCTTTTGCCAATCCACCCAACCTCCTTTCAAAAACCCAACCTTTCACCCCATCAAAGGCAATTTTGGTTTCCTTGTGTTTTGGGGAAAAGAGGCCTTTCCAAAGGTTCCGGAAAAATGGAAATTGGACAGGGGCCTTTGACGTCGAAGACCATTCCTTTTTTGGAAAAAAGGGGGGCCCACAGAGCCTTCTTTTGTTGTGGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACGGATTCCTGCACTG