ORFeome > serpinb6 ORF1 – XORFeome v1.0

serpinb6 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: serpinb6
Gene ID: 1001876
Gene Page ID: 1001869
ORF Xenbase ID: 17295927

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054232
Original XGC clone length: 1140

Human orthology & disease relationships

NCBI Entrez ID: 5269
Ensembl gene IDs: ENSG00000124570
Directly associated (OMIM) disease MIM numbers: 613453
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ839285
dbEST ID: 79656987
Trimmed Sequence: ATGGATTCCCTTAGTGCAGCGAATGGCACCTTTGCTATCAATTTCTTTGCCAAACTAAATGAAAGTAATAAAACTGGCAATATATTTGTGTCTCCTCTGAGTATTTCATCTGCTCTGGCCATGGTGCTTCTGGGTGCCAAAGGGAACACTGCTACTCAAATGTCTCAGGTTCTCAAATTTGATAAATTAGATGGTGCCCACTGTAACTTCCAATCACTTATATCTGAGATCAACAAGCCAGGCACTAATTACCTGTTAAGGACTGCCAACCGACTGTATGGGGAGAAGTCATATACATTCCTTGAGGAATTCCTCGGATCAACTCAGAAACATTACCATGCAGACCTCAGAGCAGTAGATTTTTGTAAGAAGGCAGAGGAATCCAGAGGTGAAATCAATGAGTGGGTGGCACAAAAAACCGAAGGAAAAATAAATGACCTCTTGCCTGTTGGTGCTGTGGATTCACTCACTAGATTAGTTCTTGTGAATGCAATTTACTTTAAAGGAAACTGGGCAAATAAATTTAATCCGGAGCATACTCACGAAATGCCATTCCGGCTCAATAAGAATGAAACCAAGCCTGTGCAGATGATGTACAAAAAGGCAAAGTTCCCAATGACCTATGTAGGAGAATTGTTCACCCAGGTTATAGAAATAACCCTATGTTGACAATGAACTGTCTATGAATTATTTGGCTCCCTGAATGAATATTATTGACGGCACCACCGGGATTGGAAAAACCTTTAAAAAGGAATTAAACCTATGAAAAAATTTTTTGCAAATGGAACAAATTCCCGGAAAAATAAAGGGAA
Full Trace Sequence: CGAGGCCCATATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATTCCCTTAGTGCAGCGAATGGCACCTTTGCTATCAATTTCTTTGCCAAACTAAATGAAAGTAATAAAACTGGCAATATATTTGTGTCTCCTCTGAGTATTTCATCTGCTCTGGCCATGGTGCTTCTGGGTGCCAAAGGGAACACTGCTACTCAAATGTCTCAGGTTCTCAAATTTGATAAATTAGATGGTGCCCACTGTAACTTCCAATCACTTATATCTGAGATCAACAAGCCAGGCACTAATTACCTGTTAAGGACTGCCAACCGACTGTATGGGGAGAAGTCATATACATTCCTTGAGGAATTCCTCGGATCAACTCAGAAACATTACCATGCAGACCTCAGAGCAGTAGATTTTTGTAAGAAGGCAGAGGAATCCAGAGGTGAAATCAATGAGTGGGTGGCACAAAAAACCGAAGGAAAAATAAATGACCTCTTGCCTGTTGGTGCTGTGGATTCACTCACTAGATTAGTTCTTGTGAATGCAATTTACTTTAAAGGAAACTGGGCAAATAAATTTAATCCGGAGCATACTCACGAAATGCCATTCCGGCTCAATAAGAATGAAACCAAGCCTGTGCAGATGATGTACAAAAAGGCAAAGTTCCCAATGACCTATGTAGGAGAATTGTTCACCCAGGTTATAGAAATAACCCTATGTTGACAATGAACTGTCTATGAATTATTTGGCTCCCTGAATGAATATTATTGACGGCACCACCGGGATTGGAAAAACCTTTAAAAAGGAATTAAACCTATGAAAAAATTTTTTGCAAATGGAACAAATTCCCGGAAAAATAAAGGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATTCCCTTAGTGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839284
dbEST ID: 79656986
Trimmed Sequence: TGGTGAGGCAAATCTACCACAGAAGAGAATACTGTGATTTTGTCGGTGCATAATATAAAACAGAAAAGGATGGTCACAGACAATTCTTGGTATCCTCATTGCACAACGAAGCATCATTATTGCAGCTGTAGCTGCTGCAGCTTCTGTGCCCTCTTCATTTACATCAACAAATGATTTGTGCACCACTTTAGACAGAAATAGGTCGTTGCATCCACTCATTCCAGAAAAGTCTGCCCTTCCCTGGTCAAAGGCATCAGACATTCCCATTTTACTAAGAAGTGATTCTAGATCATAATCATCCTCCAGCTTAAATTTAGGTAATGACAGTTCCATTTCTGTAATATCCATCATCTCAGGATTTGTCCATTGCAAAAACTTCTCATAGGTTAATTCCTTTTCAAGCTTTTCCAATCCCGTGGTGCCGTCATTAATATCATCAGGGAGCAATATAATCATAGACAGTTCATTGTCAACATAGGGTATTTCTATAACCTTGGTGAACAATTCTCCTACATAGGTCATTGGGAACTTTGCCTTTTTGTACATCATCTGCACAGGCTTGGTTTCATTCTTATTGAGCCGGAATGGCATTTCCTGAGTATGCTCCCGATTTAATTTATTTGCCCAGTTTCCCTTTAAGTTAATTGCATTTCACAAAAACTAATCCTGTGAAGTGAATCCACAGCAACCAACAGGGCAGAAGGTCCATTTAATTTTTTTCCTTCCGTTTTTTTTTTTCCCC
Full Trace Sequence: CGAGAAACCTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGTGAGGCAAATCTACCACAGAAGAGAATACTGTGATTTTGTCGGTGCATAATATAAAACAGAAAAGGATGGTCACAGACAATTCTTGGTATCCTCATTGCACAACGAAGCATCATTATTGCAGCTGTAGCTGCTGCAGCTTCTGTGCCCTCTTCATTTACATCAACAAATGATTTGTGCACCACTTTAGACAGAAATAGGTCGTTGCATCCACTCATTCCAGAAAAGTCTGCCCTTCCCTGGTCAAAGGCATCAGACATTCCCATTTTACTAAGAAGTGATTCTAGATCATAATCATCCTCCAGCTTAAATTTAGGTAATGACAGTTCCATTTCTGTAATATCCATCATCTCAGGATTTGTCCATTGCAAAAACTTCTCATAGGTTAATTCCTTTTCAAGCTTTTCCAATCCCGTGGTGCCGTCATTAATATCATCAGGGAGCAATATAATCATAGACAGTTCATTGTCAACATAGGGTATTTCTATAACCTTGGTGAACAATTCTCCTACATAGGTCATTGGGAACTTTGCCTTTTTGTACATCATCTGCACAGGCTTGGTTTCATTCTTATTGAGCCGGAATGGCATTTCCTGAGTATGCTCCCGATTTAATTTATTTGCCCAGTTTCCCTTTAAGTTAATTGCATTTCACAAAAACTAATCCTGTGAAGTGAATCCACAGCAACCAACAGGGCAGAAGGTCCATTTAATTTTTTTCCTTCCGTTTTTTTTTTTCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGTGAGGCAAATCTACCACAGAA