ORFeome > sh2d3c ORF1 – XORFeome v1.0

sh2d3c ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sh2d3c
Gene ID: 6254468
Gene Page ID: 6258389
ORF Xenbase ID: 17296233

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC041733
Original XGC clone length: 2031

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11008
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ823690
dbEST ID: 79641392
Trimmed Sequence: ATGCAGGTGCAGTTCTCAAAGGAGAAGTATATTCTGGAAACACCTCCTGAAAAACTGCACAAAGAGCTCGAAGAAGAATTAAAGCTCAACAGCTCTGACCCTCGCAGCCATGCCTGGTACCATGGGCGCATACCAAGGGAGGTATCTGAAAGCTTGGTTCAGAGAAACGGAGACTTCTTGATACGGGATTCCCTCACCAGCCTGGGTGACTATGTTTTGACCTGCCGATGGAAGAACGAATCTTTGCACTTTAAAATTAACAAAGTGATGGTGAAGACCAGTGACAGCTACACCAGAATACAGTATCTGTTTGAGCAGGAGAGCTTCGACAACATCCCGGCACTCGTACGCTATTACGTGGGCAGCAGGCGGCCAGTGTCAGAGCAGAGTAGCGCCATGATCTACTGCCCCATCAACCGTACATATCCACTGAGATACCTGGAAGCCAGCTATGGGCTGTCACCTGGAAGGCACGGAGGATCCCACAGTCCACAAAAGGGTCATATGAAGAGAAGAAGCATCACCATGACAGATGGACTCACTGCAGACAAGATAAACAAAAGCAACGGGTGCCCAAACAGCGGCAACTCTTCCCAGCATCATAGAGATATGATCAGAAATTGTGCAGTCAGCGTGGATCAAATCCAAGATCTGCACTCCCCAATGTCTCCCATCTCAGAAACTCCAGGGTCACCTGCCTATAGCACTGGTGTCAGAAATGAACCCCCCTGTGGAAGCCACCCAGTTTGCGCTGCTTCCAGGCTCCCAAGTCCTGGAAAAAATCCAGGTGAGCCCACTAAGTTTGGCCCCGGAAAACAAACAGGGCTGCCCTAAAAAT
Full Trace Sequence: AATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGGTGCAGTTCTCAAAGGAGAAGTATATTCTGGAAACACCTCCTGAAAAACTGCACAAAGAGCTCGAAGAAGAATTAAAGCTCAACAGCTCTGACCCTCGCAGCCATGCCTGGTACCATGGGCGCATACCAAGGGAGGTATCTGAAAGCTTGGTTCAGAGAAACGGAGACTTCTTGATACGGGATTCCCTCACCAGCCTGGGTGACTATGTTTTGACCTGCCGATGGAAGAACGAATCTTTGCACTTTAAAATTAACAAAGTGATGGTGAAGACCAGTGACAGCTACACCAGAATACAGTATCTGTTTGAGCAGGAGAGCTTCGACAACATCCCGGCACTCGTACGCTATTACGTGGGCAGCAGGCGGCCAGTGTCAGAGCAGAGTAGCGCCATGATCTACTGCCCCATCAACCGTACATATCCACTGAGATACCTGGAAGCCAGCTATGGGCTGTCACCTGGAAGGCACGGAGGATCCCACAGTCCACAAAAGGGTCATATGAAGAGAAGAAGCATCACCATGACAGATGGACTCACTGCAGACAAGATAAACAAAAGCAACGGGTGCCCAAACAGCGGCAACTCTTCCCAGCATCATAGAGATATGATCAGAAATTGTGCAGTCAGCGTGGATCAAATCCAAGATCTGCACTCCCCAATGTCTCCCATCTCAGAAACTCCAGGGTCACCTGCCTATAGCACTGGTGTCAGAAATGAACCCCCCTGTGGAAGCCACCCAGTTTGCGCTGCTTCCAGGCTCCCAAGTCCTGGAAAAAATCCAGGTGAGCCCACTAAGTTTGGCCCCGGAAAACAAACAGGGCTGCCCTAAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGGTGCAGTTCTCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829000
dbEST ID: 79646702
Trimmed Sequence: TAATTCACTGAATCGCACCGATGGCTCCAGTTTATGTGATAGAGCTGCCAGAACCTTGTCAAACTTGTCGTATCTTTCTGCCTGGCTGCCCGAAGCTCCCCGGCTTCCCCACAGCATCCGCATCTGGAATTCTGTGCTTGAGACTTCTAAGAGATCAGATCTGGGGTGGAACCCTTGTAACCTCACCTCTGCGTTGGTACGGTAAAGGCCTCCGTGATGTGCCACCATCCGGGCAGCCTCCAAGTGTGCCATAACCACTTCTACTCCGTTATCAGAACTGTCCCAGGGCTCCCCACTGTCCAGAAGAGGGCTGTCTCGCTCAAGGAGGGTGATTAGGGGAATGATGTGAGGGAAGGTTGTGTTGCTCAGAGGTAGGCTTTCTTTGCCCTCATTCATGCTCTTCAAAAATGGCTTCAGCTTCTTCTCATACAAGATGGCTCCCTCTGTGTGCCTCTGCCTTAGTGTTACCCATGTTTGCTCCAAGCGTGAGATCTGTGACATTTCCAGTGCATTCATCACAGCAGCAAAACTGAACATGTTTCCCATGGTGCCTTTTAGTTCCGCTGCAAGCTGGATAGTCTTATGCAGGAGAGCAGCCCTTTCTTCGGTGCTCCCTGTGCAACCCAAGATGTCTACTGCGATCATGATGGGACATGGGTGTGAAAACCTTTCTAGTAGAATCGAGCCCGCAGTTGGGGGCCCATGGCGGGCAGCGGTCAGTTAGCCTCCATGGCCTGGAACCTCCCTTCCCCAAAAACCCCTTTGGCCATCCT
Full Trace Sequence: GGACGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAATTCACTGAATCGCACCGATGGCTCCAGTTTATGTGATAGAGCTGCCAGAACCTTGTCAAACTTGTCGTATCTTTCTGCCTGGCTGCCCGAAGCTCCCCGGCTTCCCCACAGCATCCGCATCTGGAATTCTGTGCTTGAGACTTCTAAGAGATCAGATCTGGGGTGGAACCCTTGTAACCTCACCTCTGCGTTGGTACGGTAAAGGCCTCCGTGATGTGCCACCATCCGGGCAGCCTCCAAGTGTGCCATAACCACTTCTACTCCGTTATCAGAACTGTCCCAGGGCTCCCCACTGTCCAGAAGAGGGCTGTCTCGCTCAAGGAGGGTGATTAGGGGAATGATGTGAGGGAAGGTTGTGTTGCTCAGAGGTAGGCTTTCTTTGCCCTCATTCATGCTCTTCAAAAATGGCTTCAGCTTCTTCTCATACAAGATGGCTCCCTCTGTGTGCCTCTGCCTTAGTGTTACCCATGTTTGCTCCAAGCGTGAGATCTGTGACATTTCCAGTGCATTCATCACAGCAGCAAAACTGAACATGTTTCCCATGGTGCCTTTTAGTTCCGCTGCAAGCTGGATAGTCTTATGCAGGAGAGCAGCCCTTTCTTCGGTGCTCCCTGTGCAACCCAAGATGTCTACTGCGATCATGATGGGACATGGGTGTGAAAACCTTTCTAGTAGAATCGAGCCCGCAGTTGGGGGCCCATGGCGGGCAGCGGTCAGTTAGCCTCCATGGCCTGGAACCTCCCTTCCCCAAAAACCCCTTTGGCCATCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATTCACTGAATCGCACCGATG