ORFeome > sult5a1 ORF1 – XORFeome v1.0

sult5a1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: unnamed
Gene ID: 5871008
Gene Page ID: 5871002
ORF Xenbase ID: 17299509

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123212
Original XGC clone length: 867

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ838273
dbEST ID: 79655975
Trimmed Sequence: ATGGACAGAATGGATGACACAGAAAGCATTGCAGGGATCCTGCTGCCTGGGCACTTACACTCTCAGCAGTCCTTGCAGTATGCTCAGGATTTTCAGTTCAAGGAAGAGGATATTGTCATTGTTACTTATCCCAAATCAGGCACCACCTGGATGCAGGAGATTTTGACTTTGATTTACAGTAGAGGGGATGATGACATAGCTACAACTGTCCCTAACTGGAGGCGTGCACCCTGGCTTGAGCATATATACTTTAAAGATGTTATTATAGAAGGGAATGGCCCCAGAATCATCACAACCCACCTTCCCAGTGACGTGCTGGCACCTGCACTGCAAAAGTCTAAAGCAAAAGTTATTTATGTTGCAAGGAATCCCAAAGATGTGGCTGTTTCCTACTACTACTTTCACAAGATGGCCAGGTTCTTACCAAACCCTCAACCCTTTCCAGAATTCCTGGAGAAGTTTCTAGAAGGAAAAGTATATTATGGTTCTTGGTTTGAGCATGTGAAAGACTGGCACAGCGTCAGCCAGACCCTGGATTTCTTCTACATAACATATGAAGACATGCAAAAGGACTTGAGAAGATCCATAAAGAAGATATGTCAATTCCTGGAAACTCGCATGTACTTCCAGGAAGTGGACAAGGTGGAGCAGCACAGCAATTTTGCTGTTATGAGTCAAATTCCATGGTGAATTTAACCCTTAATCCATGTGAAATCATGGACCAACATCAAAACAAGTTTTAATAAAAAAGGGTTCATGGGAAAAAGTGGCAAACAACTTTTTCCCTTAAAAAACAAAAAAAAAAA
Full Trace Sequence: CGTGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACAGAATGGATGACACAGAAAGCATTGCAGGGATCCTGCTGCCTGGGCACTTACACTCTCAGCAGTCCTTGCAGTATGCTCAGGATTTTCAGTTCAAGGAAGAGGATATTGTCATTGTTACTTATCCCAAATCAGGCACCACCTGGATGCAGGAGATTTTGACTTTGATTTACAGTAGAGGGGATGATGACATAGCTACAACTGTCCCTAACTGGAGGCGTGCACCCTGGCTTGAGCATATATACTTTAAAGATGTTATTATAGAAGGGAATGGCCCCAGAATCATCACAACCCACCTTCCCAGTGACGTGCTGGCACCTGCACTGCAAAAGTCTAAAGCAAAAGTTATTTATGTTGCAAGGAATCCCAAAGATGTGGCTGTTTCCTACTACTACTTTCACAAGATGGCCAGGTTCTTACCAAACCCTCAACCCTTTCCAGAATTCCTGGAGAAGTTTCTAGAAGGAAAAGTATATTATGGTTCTTGGTTTGAGCATGTGAAAGACTGGCACAGCGTCAGCCAGACCCTGGATTTCTTCTACATAACATATGAAGACATGCAAAAGGACTTGAGAAGATCCATAAAGAAGATATGTCAATTCCTGGAAACTCGCATGTACTTCCAGGAAGTGGACAAGGTGGAGCAGCACAGCAATTTTGCTGTTATGAGTCAAATTCCATGGTGAATTTAACCCTTAATCCATGTGAAATCATGGACCAACATCAAAACAAGTTTTAATAAAAAAGGGTTCATGGGAAAAAGTGGCAAACAACTTTTTCCCTTAAAAAACAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACAGAATGGATGACACAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838272
dbEST ID: 79655974
Trimmed Sequence: TTTTAAGGTCCAAATAAACTGTAGATCACAGTCTGACATTTTTTCTTGAAAAACCTTATCAAACATTTTGTTCTGCTCTTCAGTGAAATGTTGTTGCCAGTCTCCCACGACACCTTTTCTCATAAACTTGCTCTGAGTGTGGTCCATGATCTCACATGGAATAAGGGTGTAATTCACCATGGAATTTTGACTCATAACAGCAAAATTGCTGTGCTGCTCCACCTTGTCCACTTCCTTGGAGTACATGGGAGTTTCCAGGAATTGACATATCTTCTTTATGGATCTTCTCAAGTCCTTCTGCATGTCTTCATATGTTATGTAGAAAAAATCCAGGGTCTGGCTGACGCTGTGCCAGTCTTTCACATGCTCAAACCAAGAACCATAATATACTTTTCCTTCTAGAAACTTCTCCAGGAATTCTGGAAAGGGTTGAGGGTTTGGTAAGAGCCTGGCCATCTTTTGAAAGTAGTAATAAGAAACAACCACATCTTTTTCATTCCTTGCAACATAAATAACTTTTGCTTTAGACTTTTGCATTGCAGGTGCGAGCACGTCACTCTGGAGGGGGGGGTGTGGGGGATGGTGGGGCCGTGGCCTTCAACTATAACATCATTAACGTTATTTATTAGTCAGAGCGGCGGGGGGGGGGGCGAGCGTCCCCCCCTTTGGTGAGGTGGTGAAGCATCCCCCCCCCCCTCTCCATTCGAAATAGAAAAATTACGTACGCCTGAGGCCGGCGCGCGGTGATTTGGGGTGATAATAAAAGGAAAAAGAAAAT
Full Trace Sequence: GGAAATACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTAAGGTCCAAATAAACTGTAGATCACAGTCTGACATTTTTTCTTGAAAAACCTTATCAAACATTTTGTTCTGCTCTTCAGTGAAATGTTGTTGCCAGTCTCCCACGACACCTTTTCTCATAAACTTGCTCTGAGTGTGGTCCATGATCTCACATGGAATAAGGGTGTAATTCACCATGGAATTTTGACTCATAACAGCAAAATTGCTGTGCTGCTCCACCTTGTCCACTTCCTTGGAGTACATGGGAGTTTCCAGGAATTGACATATCTTCTTTATGGATCTTCTCAAGTCCTTCTGCATGTCTTCATATGTTATGTAGAAAAAATCCAGGGTCTGGCTGACGCTGTGCCAGTCTTTCACATGCTCAAACCAAGAACCATAATATACTTTTCCTTCTAGAAACTTCTCCAGGAATTCTGGAAAGGGTTGAGGGTTTGGTAAGAGCCTGGCCATCTTTTGAAAGTAGTAATAAGAAACAACCACATCTTTTTCATTCCTTGCAACATAAATAACTTTTGCTTTAGACTTTTGCATTGCAGGTGCGAGCACGTCACTCTGGAGGGGGGGGTGTGGGGGATGGTGGGGCCGTGGCCTTCAACTATAACATCATTAACGTTATTTATTAGTCAGAGCGGCGGGGGGGGGGGCGAGCGTCCCCCCCTTTGGTGAGGTGGTGAAGCATCCCCCCCCCCCTCTCCATTCGAAATAGAAAAATTACGTACGCCTGAGGCCGGCGCGCGGTGATTTGGGGTGATAATAAAAGGAAAAAGAAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTAAGGTCCAAATAAACTGTA