ORFeome > tktl2 ORF1 – XORFeome v1.0

tktl2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tktl2
Gene ID: 1002829
Gene Page ID: 1002823
ORF Xenbase ID: 17300943

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056101
Original XGC clone length: 1878

Human orthology & disease relationships

NCBI Entrez ID: 84076
Ensembl gene IDs: ENSG00000151005
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 125800,125851,164300,212065,248500,601382,602485,602579,606003

Library Location

Plate ID: GDExl11021
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ824754
dbEST ID: 79642456
Trimmed Sequence: ATGGACACCTACCAGAAACCAGAGGACAAGGAGCTGCAGGGCCTTAGGGACGTGGCCAACCGGCTGCGGATTCATTCCATCAGGGCAACGTGCGCCTCTAACTCGGGGCATCCCACTTCCTGCTGCAGTGCTGCTGAAGTCCTCTCTGTGCTTTTCTTCAACACCATGAGATATGAAGCAGGTGATCCTGCGAATGCTAACAATGATCGCTTTGTTCTGTCAAAGGGCCATGCTGCGCCTATCCTCTATGCTGCTTGGGCAGAGGCCGGCTTCATTAAGCAATCTGATCTGCTCAACTTGAGGAAGATAGATTGTGACCTGGAAGGACATCCAACCCCTAAATTGCCCTTTGTTGATGTTGCAACTGGTTCCTTAGGACAAGGGCTGGGGGCATCTTGCGGCATGGCATACACTGGAAAATACTTCGACAAAGCTAGTTACCGGGTCTATTGCTTATTGGGAGATGGTGAATCCTCCGAAGGTGCTGTCTGGGAAGCCATGGCATTTGCCTCACATTACCATTTGGACAACCTTGTAGCCATATTTGATGTAAACCGCTTGGGCCAGAGTGAAGCTGCACCTCTTCAGCACCAGACTGATATATACATGAAGAGATGTGAAGCCTTTGGATGGACACCTATGTTGTGGACGGCCATGATGTGGCAGAGCTATGCCATGCTTTCTGGCAGGCTGCTCATGTGAAGGGACAGCCCACAGCCATCATTGGCTAAAACCTTCAAAGGCAAAAGCCATTCTCCGGGGGTTGAAAAAAGAAAAACAACGGGGCAGGGGAAAGCCCTATGCCCC
Full Trace Sequence: CAGTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACACCTACCAGAAACCAGAGGACAAGGAGCTGCAGGGCCTTAGGGACGTGGCCAACCGGCTGCGGATTCATTCCATCAGGGCAACGTGCGCCTCTAACTCGGGGCATCCCACTTCCTGCTGCAGTGCTGCTGAAGTCCTCTCTGTGCTTTTCTTCAACACCATGAGATATGAAGCAGGTGATCCTGCGAATGCTAACAATGATCGCTTTGTTCTGTCAAAGGGCCATGCTGCGCCTATCCTCTATGCTGCTTGGGCAGAGGCCGGCTTCATTAAGCAATCTGATCTGCTCAACTTGAGGAAGATAGATTGTGACCTGGAAGGACATCCAACCCCTAAATTGCCCTTTGTTGATGTTGCAACTGGTTCCTTAGGACAAGGGCTGGGGGCATCTTGCGGCATGGCATACACTGGAAAATACTTCGACAAAGCTAGTTACCGGGTCTATTGCTTATTGGGAGATGGTGAATCCTCCGAAGGTGCTGTCTGGGAAGCCATGGCATTTGCCTCACATTACCATTTGGACAACCTTGTAGCCATATTTGATGTAAACCGCTTGGGCCAGAGTGAAGCTGCACCTCTTCAGCACCAGACTGATATATACATGAAGAGATGTGAAGCCTTTGGATGGACACCTATGTTGTGGACGGCCATGATGTGGCAGAGCTATGCCATGCTTTCTGGCAGGCTGCTCATGTGAAGGGACAGCCCACAGCCATCATTGGCTAAAACCTTCAAAGGCAAAAGCCATTCTCCGGGGGTTGAAAAAAGAAAAACAACGGGGCAGGGGAAAGCCCTATGCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACACCTACCAGAAACCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ830106
dbEST ID: 79647808
Trimmed Sequence: ATTTGCAAAAGTAGTTTTAACAGCTTCAACAATGCATCTAGCACTTATGCCAAACATGTCTAGAAGTTCAGTTGGCTTTCCACTTCGGGGCACACCACGCACAGCCAAGGTCTGGACAATAAACCCTGGTTCTCCTGCAACTGCAGCACAGACGGCTTCTCCAATTCCACCTTCTCTGTAATGATCTTCCACTGTAATTATATGTCCGCCTGTTGCCCGGCCACTGGACAGAATGGTTGCAGCATCCAATGGTTTAATGGTGAAAGGGTCAATCACACGGATATTGATGCCTTGTTTGGCAAGTTCATCAGCTGCTGCCAAGGCCTCATGTAAAGTGACTCCAGCACCGATAACGGTTACCCTGTCGGAGCTGCTCTGGCGCACCACCTTTGCTTGCCCAATTTCAAACTTCTCCTCTGGAGAATATATAACAGCAGTGTCTGGACGGCTGGTTCGGATGAAGCAGATACCTGGAGTGTTGGCTGATAGAAAGACAGCATGCTCAGTGGAAACTCCATCACTGGGATAAAAGACTGTACAAGTTGGAATAGCACGGAACATTGAAAGATCCTCCAAAGCCATCTGAGAGGGCCCATCCTCACCCATAGAGACTCCACAGTGAGAGCCCACAGAGATTGACGTTTGGATTGCGAAATGGCCCCCATGCCGATGTGATCATAAGCCCCTGGGAGAGGAAAGGCGGCCAAACGTGCTGGGCAAAAACCACTGGGGGCGACCCCCTGGGGGGGAAAACCCCAAAACCC
Full Trace Sequence: GGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTTGCAAAAGTAGTTTTAACAGCTTCAACAATGCATCTAGCACTTATGCCAAACATGTCTAGAAGTTCAGTTGGCTTTCCACTTCGGGGCACACCACGCACAGCCAAGGTCTGGACAATAAACCCTGGTTCTCCTGCAACTGCAGCACAGACGGCTTCTCCAATTCCACCTTCTCTGTAATGATCTTCCACTGTAATTATATGTCCGCCTGTTGCCCGGCCACTGGACAGAATGGTTGCAGCATCCAATGGTTTAATGGTGAAAGGGTCAATCACACGGATATTGATGCCTTGTTTGGCAAGTTCATCAGCTGCTGCCAAGGCCTCATGTAAAGTGACTCCAGCACCGATAACGGTTACCCTGTCGGAGCTGCTCTGGCGCACCACCTTTGCTTGCCCAATTTCAAACTTCTCCTCTGGAGAATATATAACAGCAGTGTCTGGACGGCTGGTTCGGATGAAGCAGATACCTGGAGTGTTGGCTGATAGAAAGACAGCATGCTCAGTGGAAACTCCATCACTGGGATAAAAGACTGTACAAGTTGGAATAGCACGGAACATTGAAAGATCCTCCAAAGCCATCTGAGAGGGCCCATCCTCACCCATAGAGACTCCACAGTGAGAGCCCACAGAGATTGACGTTTGGATTGCGAAATGGCCCCCATGCCGATGTGATCATAAGCCCCTGGGAGAGGAAAGGCGGCCAAACGTGCTGGGCAAAAACCACTGGGGGCGACCCCCTGGGGGGGAAAACCCCAAAACCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTTGCAAAAGTAGTTTTAACAG