ORFeome > tm4sf5 ORF1 – XORFeome v1.0

tm4sf5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tm4sf5
Gene ID: 6255242
Gene Page ID: 969430
ORF Xenbase ID: 17300991

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129570
Original XGC clone length: 588

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ838656
dbEST ID: 79656358
Trimmed Sequence: ATGTGCACTGGCAAATGCTCTCGCTTCTTGGGCTTGTCTCTGCTCCCCATGTCCCTGAGCTGCATCATTGCCAATGTCCTCCTCTTCTTCCCTAATGGAAAGACCATCAGCACCAACCACATCACCCTCCAAGTCTGGCTGATGGGCGGCATTATAGGAGGGGGCCTCTTTGTCCTGTGTCCGGCCTTTGCAGCGATTCGTGCAGGGGGGGAAGGCTGCTGTGGGGCTGGATGCTGTGGAAACCGATGCAGAATGCTCCGCTCAGTCTTCTCCTCCATATTCGGTGCTCTGGGAGGATTCTATTGCCTGATCGTGTCAGGCACAGGCCTGTCTGATGGACCTTTGTGCCTCATGGGGGGGCAGTGGAAATATCCCTTTAAGGGCCAAACTGATAGTTACCTGTTCAATAAGACTTCTTGCGATGACTGTGAGGAGCCTAAAAAGATTGTGCTGTGGAACATTGTCCTGTTTTCTATGCTCCTTGGGTTCGGTGCTCTAGAGTTTGTCCTCTGTGCCATCCAAATTGTCAACGGACTCATGGGCGTGTTGGGTGGGGACTGCAAAAAAAAAGGGAAGAATGAAAGCTT
Full Trace Sequence: CTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGCACTGGCAAATGCTCTCGCTTCTTGGGCTTGTCTCTGCTCCCCATGTCCCTGAGCTGCATCATTGCCAATGTCCTCCTCTTCTTCCCTAATGGAAAGACCATCAGCACCAACCACATCACCCTCCAAGTCTGGCTGATGGGCGGCATTATAGGAGGGGGCCTCTTTGTCCTGTGTCCGGCCTTTGCAGCGATTCGTGCAGGGGGGGAAGGCTGCTGTGGGGCTGGATGCTGTGGAAACCGATGCAGAATGCTCCGCTCAGTCTTCTCCTCCATATTCGGTGCTCTGGGAGGATTCTATTGCCTGATCGTGTCAGGCACAGGCCTGTCTGATGGACCTTTGTGCCTCATGGGGGGGCAGTGGAAATATCCCTTTAAGGGCCAAACTGATAGTTACCTGTTCAATAAGACTTCTTGCGATGACTGTGAGGAGCCTAAAAAGATTGTGCTGTGGAACATTGTCCTGTTTTCTATGCTCCTTGGGTTCGGTGCTCTAGAGTTTGTCCTCTGTGCCATCCAAATTGTCAACGGACTCATGGGCGTGTTGGGTGGGGACTGCAAAAAAAAAGGGAAGAATGAAAGCTTGCCAACTTTCTTGTACAAAGTTGGCATTAAAAAAAAGCATTGCTTATCAATTTTTTGCAAACAACAGGTCACAATAAGTCAAAATAAAATTATTATTTTGCCATCAACGTAAAATCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGCACTGGCAAATGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838655
dbEST ID: 79656357
Trimmed Sequence: GCCTTCATTCTTGCCCTTCTTTCTGCAGTCCCCACACAACACGCCCATGAGTCCGTTGACAATCTGGATGGCACAGAGGACAAACTCTAGAGCACCGAACCCAAGGAGCATAAAAGACAGGACAATGTTCCACACCACAATCTTTTTAGGCTCCTCACAGTCATCCCAAGAAGTCTTATTGAACAGGTAACTCTCAGTTTGGCCCTTAAAGGGATATTTCCACTGCCCCCCCATGACGCACAAAGGTCCGTCACACAGGCCTGTGCCTGACACAATCAGGCAATAGAATCCTCCCAGAGCACCTAATATGGAGGAGAATACTGAGCGGAGCATTCTGCATCGGTTTCCACACCATCCAGCCCCGCACCAGCCTTCCCCCCCTGCACGAATCGCTGCATAGGCCGGACACAGGACAAAGAGGCCCCCTGCCATAATGCCGCCCATCAGCCAGACTTGCAGGGTGAAGTGGTTGGTGCTGATGGTCTTTCCATTAGGAAGAAACAAGAGGAACTTGTACATAATGCAACTTAAGGGAAATGCGGAGCATAAAACCACCCTAAGAAGCCATACCATTCTGGCAGGGCAAATGGTTGCCAACGTTTTTCGTACAAGGTTGGGCATTTAAAAAAAACCCTTGGCTCATCATTTTGTTGGCAACGAAACAGGTCACTTACCATTCAAAATAAAATTCATTAAATTTAGGGACCAAGAAAAATAAAAAACTGGCCCGTTCGTTTTTAAAA
Full Trace Sequence: GGGAATCGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCCTTCATTCTTGCCCTTCTTTCTGCAGTCCCCACACAACACGCCCATGAGTCCGTTGACAATCTGGATGGCACAGAGGACAAACTCTAGAGCACCGAACCCAAGGAGCATAAAAGACAGGACAATGTTCCACACCACAATCTTTTTAGGCTCCTCACAGTCATCCCAAGAAGTCTTATTGAACAGGTAACTCTCAGTTTGGCCCTTAAAGGGATATTTCCACTGCCCCCCCATGACGCACAAAGGTCCGTCACACAGGCCTGTGCCTGACACAATCAGGCAATAGAATCCTCCCAGAGCACCTAATATGGAGGAGAATACTGAGCGGAGCATTCTGCATCGGTTTCCACACCATCCAGCCCCGCACCAGCCTTCCCCCCCTGCACGAATCGCTGCATAGGCCGGACACAGGACAAAGAGGCCCCCTGCCATAATGCCGCCCATCAGCCAGACTTGCAGGGTGAAGTGGTTGGTGCTGATGGTCTTTCCATTAGGAAGAAACAAGAGGAACTTGTACATAATGCAACTTAAGGGAAATGCGGAGCATAAAACCACCCTAAGAAGCCATACCATTCTGGCAGGGCAAATGGTTGCCAACGTTTTTCGTACAAGGTTGGGCATTTAAAAAAAACCCTTGGCTCATCATTTTGTTGGCAACGAAACAGGTCACTTACCATTCAAAATAAAATTCATTAAATTTAGGGACCAAGAAAAATAAAAAACTGGCCCGTTCGTTTTTAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCTTCATTCTTGCCCTT