ORFeome > tmem194a ORF1 – XORFeome v1.0

tmem194a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tmem194a
Gene ID: 6252472
Gene Page ID: 974572
ORF Xenbase ID: 17301369

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123326
Original XGC clone length: 1305

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ837336
dbEST ID: 79655038
Trimmed Sequence: ATGGCGGGAGACGTGGAAGGAGGAGGCTGTAGAGTTAGTTGGGGAGCTCTGCTCACCTTGCTCTTATTACCGCTGCCGTCATTATGTACATTGGCCTCAGGAAAGGAACCACATGTGATTAAACTCTATGACGGTAAAGTGGTCCGGTACAATGACTCTAAAAATTTCTGCTACCAGAGAACATATGAACCAAAATGGAGTGACGTTTGGACTAAGATACAGATACGTGTAAACAGCACTAAAATGATAAGAGTGACCCAAGTGGAAAATGAAGAGAAGCTAAAGGAAATGGAAACTTTCAACATGTTTGACCTTTTCTCATCTTTTCTCAAGGAAAAACTAAATGATACATTCATATATGTGGATCTCTACAGCAACAAAACTTGTATTAAAGTGCATGTAATAGACACTGACACTTACTACAGTGTTGCACTTTCTCGAGGATTTGATCCCAGACTGTGCTTTCTGTTCTTATGTGGCCTTTTGCTATTCTTTTATGGTGACACACTGAGCAGAAGCCAACTCTTCTTCTACAGCACAGGTATCACTGTAGGTATGTTGGCTTCCATGCTGATACTTGTGTTCATGCTCTCCAAACTGATGCCAAAGAAAAGTCCATTTGTTGCATTACTGCTTTGGAAGGATGGTCTGGTTCCATTTTACATATTCCAACTGGTCTTCAAAAATTTACAGGCTATCTTGCATTAATACTGGCAATATCCTTTTTGGTTATCTTGTTATTTGTTGGGATTTTTCTCGTTTTGCTTTTTTGTTTTTATTTTGGTCCCCTTTGAAAAAGGGCCCCGCCCCCCCCACCAATTTT
Full Trace Sequence: GGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGGAGACGTGGAAGGAGGAGGCTGTAGAGTTAGTTGGGGAGCTCTGCTCACCTTGCTCTTATTACCGCTGCCGTCATTATGTACATTGGCCTCAGGAAAGGAACCACATGTGATTAAACTCTATGACGGTAAAGTGGTCCGGTACAATGACTCTAAAAATTTCTGCTACCAGAGAACATATGAACCAAAATGGAGTGACGTTTGGACTAAGATACAGATACGTGTAAACAGCACTAAAATGATAAGAGTGACCCAAGTGGAAAATGAAGAGAAGCTAAAGGAAATGGAAACTTTCAACATGTTTGACCTTTTCTCATCTTTTCTCAAGGAAAAACTAAATGATACATTCATATATGTGGATCTCTACAGCAACAAAACTTGTATTAAAGTGCATGTAATAGACACTGACACTTACTACAGTGTTGCACTTTCTCGAGGATTTGATCCCAGACTGTGCTTTCTGTTCTTATGTGGCCTTTTGCTATTCTTTTATGGTGACACACTGAGCAGAAGCCAACTCTTCTTCTACAGCACAGGTATCACTGTAGGTATGTTGGCTTCCATGCTGATACTTGTGTTCATGCTCTCCAAACTGATGCCAAAGAAAAGTCCATTTGTTGCATTACTGCTTTGGAAGGATGGTCTGGTTCCATTTTACATATTCCAACTGGTCTTCAAAAATTTACAGGCTATCTTGCATTAATACTGGCAATATCCTTTTTGGTTATCTTGTTATTTGTTGGGATTTTTCTCGTTTTGCTTTTTTGTTTTTATTTTGGTCCCCTTTGAAAAAGGGCCCCGCCCCCCCCACCAATTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGAGACGTGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837335
dbEST ID: 79655037
Trimmed Sequence: AAAGCAAGATCTTGGAACTAGATAAAGTGGCTGTTCAATATCCATTTCTACCTCAATGTCACTGTCCTCTCCAAACAATTCATCTTCCAAGAAAGAACCCCCTAAACCGTACTCGTGCTCATGAACAGATACTTCATTGGGTGTCAGGTGAGATGACCCTTCAACAAAATCAGCAAATCTCTTGGGTGACTGGATGCGAGAAATCATTTTCCATGTTGCAAAATCTGGACTACTGCAATATCCTCGTAAATCCTCCAAAGCTTTTCTGGTTTCAATTTCTCCTTGTTTTCGGTATTCCTCTTCTGTTAGCAGGCGGGGAGGACTTGGCTTAGCTCTCTTACGTTTTATTTTTCTGTATAGTATGTAAATCCATTGTACTGGATATTCTATCTGTTTGGTACAAAATGCAATGACTACCATGGTCACAGCTATGTGCTGTATTTGCACACTGATGTACATTAGCAGCAGACCAATCAACTGTAGTGTCCAGTTCAAAATGTTGATGCTGCGGTCATTCTCCAAGGGCCCATATTTATAACAAAAAGCAAAACTGACAAATCCAACAATACCAAGATAACCCAAAAGATACTGCCAGTATTCACTGCAAATAGCCCTGTAATTTTTGAAGACCGTTTGGAATATGTAAATGGAAACAGGCCATCCCTCCAACCGTAATGCAACAAATGGACTTTTCCTTTGGCATCCTTTTTGGAAACCTGAAACCCAAGTACCAAGCCTGGAAAACCAAAAAACCCAACCCGGAAAAACCGTTGTTCCT
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAGCAAGATCTTGGAACTAGATAAAGTGGCTGTTCAATATCCATTTCTACCTCAATGTCACTGTCCTCTCCAAACAATTCATCTTCCAAGAAAGAACCCCCTAAACCGTACTCGTGCTCATGAACAGATACTTCATTGGGTGTCAGGTGAGATGACCCTTCAACAAAATCAGCAAATCTCTTGGGTGACTGGATGCGAGAAATCATTTTCCATGTTGCAAAATCTGGACTACTGCAATATCCTCGTAAATCCTCCAAAGCTTTTCTGGTTTCAATTTCTCCTTGTTTTCGGTATTCCTCTTCTGTTAGCAGGCGGGGAGGACTTGGCTTAGCTCTCTTACGTTTTATTTTTCTGTATAGTATGTAAATCCATTGTACTGGATATTCTATCTGTTTGGTACAAAATGCAATGACTACCATGGTCACAGCTATGTGCTGTATTTGCACACTGATGTACATTAGCAGCAGACCAATCAACTGTAGTGTCCAGTTCAAAATGTTGATGCTGCGGTCATTCTCCAAGGGCCCATATTTATAACAAAAAGCAAAACTGACAAATCCAACAATACCAAGATAACCCAAAAGATACTGCCAGTATTCACTGCAAATAGCCCTGTAATTTTTGAAGACCGTTTGGAATATGTAAATGGAAACAGGCCATCCCTCCAACCGTAATGCAACAAATGGACTTTTCCTTTGGCATCCTTTTTGGAAACCTGAAACCCAAGTACCAAGCCTGGAAAACCAAAAAACCCAACCCGGAAAAACCGTTGTTCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAGCAAGATCTTGGAACTAGATA