ORFeome > tmem59 ORF1 – XORFeome v1.0

tmem59 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tmem59
Gene ID: 970580
Gene Page ID: 970575
ORF Xenbase ID: 17301651

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084373
Original XGC clone length: 969

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCGCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGATACAAGAGGCTTATTGGTTGTTCTCTTGCTTTGTGCCAGCGCTTGGGCAACAGAACCTGCTGCAAATGTAGACTCCCTGCTGGGGGACAGCACGTCTTGTCAGGGTGTGTGCGAAGGAACTTACCCGTTGCACACCTTCCCCGAGGAGGAGGAGCTGTTTGCCTGTCAGAGGGGCTGTCGTCTCTTTTCTATCTGCCTATTTGAGGATGAAGAAGAGGATTTGAACACAACTAATGTTGAATGTGAATCATCTTGCTTGGAATCTTATCCACCATCCACTGAACAATATGCTTGCAACTTGTGCTGCCAAAGTCAAATGCCTTTTTCAACACACCGCCAAGAACATCTTGAATATTTACCTCCTCTTATTCACATCCTCTTTCCCCTTGTTTTTGTAGCATCTTTCAGAAAAGACATGCAGTATTCTGCACAAAACTTTATTAACCCCTCAAGGACCTTTTATGTTCAAGATGATGATAGGATGATTATTGTTGTCTAGTCTGAATCTTACTTCCATCATGATCCACAGTTTCTTCCAGAGGAAGCACAACCTGAACAACACTTTCTAGACAAGATGTCATTTCATCCTGTGCCTGCTGAATCTGCGCAGCAGTATAAAGAAAAGACGACTTGAGACCTACCATCTGACTCTATTAATCATGATAAAAGCAACAACTTTTTAAACTGCTCCTCTACTAATTCTAATTGGCTTCTTTCGACCAATCTTCCTCCTGACCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGATACAAGAGGCTTA

Sequences - 3ʹ (reverse) EST

Accession: JZ840002
dbEST ID: 79657704
Trimmed Sequence: TATAGCTGACTGTGTTAGGTCCACCTTTGTTGGTATAGGTCCTGCATCTTCACTTTCTTCGAGTTTTCCATGAACAACAACAAGAGTTGCAGGGGGATATCTGTGCAATTTCTGCTCATTCATGTATTCCAGGTCTCCATAGATACTCAGCTTTTCAGAGGGGGTGTACTGGTCCGAGGCTGTAGCGACAGTAGCACAACAAATCCATAGAAGAACCAAAACTGACAGGACCAGAGTCGCAGAAAGAAGCCAATTAGAATTCGCAGAGAAGCACTTTAAAAAGTTGTTGCCTTCATCAAGATTAAGTGAGTCAGATCGCAGGTCCCAAGTCCTTTCTTCTCTATACTGCCCCGCAGATTCAGCAGGCACAGGATCTAATGACATTTTGTCTAGAAAGTGTTCTGCAGGTTGTGCCTTTTCTGGAAGAAACTGTGGATCATGCTGGAATTCAGATTCAGACTGGACAACAATAATCCTCCCATTATCTGCCTGAACATAANAGGTCCATGAGGAGTTAATAAAGTTTTGTGCAGAATCCAGCATGTCTCTCCAGAAAGCTCCCCACAAAACAAGGGGAAAAGAGGATGTGAATCCCAGGAGCTAAATCTGCAAGCTCTTCCTGGCGCTTTGCTGAAAAAAGGCATTGAATTTTGCAACCCAAGTTGCCAGCAAATTGCCTCAGGGGAATTGTGGAAAAACTTTCCAACCCACCTAAATCCC
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATAGCTGACTGTGTTAGGTCCACCTTTGTTGGTATAGGTCCTGCATCTTCACTTTCTTCGAGTTTTCCATGAACAACAACAAGAGTTGCAGGGGGATATCTGTGCAATTTCTGCTCATTCATGTATTCCAGGTCTCCATAGATACTCAGCTTTTCAGAGGGGGTGTACTGGTCCGAGGCTGTAGCGACAGTAGCACAACAAATCCATAGAAGAACCAAAACTGACAGGACCAGAGTCGCAGAAAGAAGCCAATTAGAATTCGCAGAGAAGCACTTTAAAAAGTTGTTGCCTTCATCAAGATTAAGTGAGTCAGATCGCAGGTCCCAAGTCCTTTCTTCTCTATACTGCCCCGCAGATTCAGCAGGCACAGGATCTAATGACATTTTGTCTAGAAAGTGTTCTGCAGGTTGTGCCTTTTCTGGAAGAAACTGTGGATCATGCTGGAATTCAGATTCAGACTGGACAACAATAATCCTCCCATTATCTGCCTGAACATAANAGGTCCATGAGGAGTTAATAAAGTTTTGTGCAGAATCCAGCATGTCTCTCCAGAAAGCTCCCCACAAAACAAGGGGAAAAGAGGATGTGAATCCCAGGAGCTAAATCTGCAAGCTCTTCCTGGCGCTTTGCTGAAAAAAGGCATTGAATTTTGCAACCCAAGTTGCCAGCAAATTGCCTCAGGGGAATTGTGGAAAAACTTTCCAACCCACCTAAATCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATAGCTGACTGTGTTAGGTCCA