ORFeome > tprg1 ORF1 – XORFeome v1.0

tprg1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tprg1
Gene ID: 6254631
Gene Page ID: 951619
ORF Xenbase ID: 17302185

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC063732
Original XGC clone length: 795

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ824804
dbEST ID: 79642506
Trimmed Sequence: ATGGCGTCTGGTCAAGCAGAAGAGTTCCGACCCGTGGAACTGGGAGGGCAGGAGCTCCCTAAATCAGATGACTCGAAGAACACTGCAAGCCAGAAGGAGCAAGCGCCGGCACCTCCTAATAATACTGAGCCACATCAATTGAATGACTACCTTATGAGAAAGTATTTTGTGGCCAGGCCAGGAGCATTTGAGCAGGCCAACGAAGACTTGACAAATCAGATTTTTACAAAGGAAAATGAAACTGTGAACAGTGCCTGGCTTTTGGCAGAAGTTGATCACTGGAACAATGAGAAGGAGCGGCTTGTTCTCATCACTGATAAAAGTCTTTTCATTTGTAAATACGACTTTATCATGCTGTGCTGCCAGCAGATTCAGAAGGTTCCTCTCAATTACATTGACAAAATATGCCTTGGACCGTTCACATTCCCTCAGAGATCTCTCGACAAGAGAGAAGGCGAGGGTCTTCGAGTTCATTGGGATAAACTGCGTGAAGCCTCTTTTGCCAATCGCTGGAATCCATTTTCAGAGGCTTTACCTTACACTACTTTTATTGATCACCCCTTGAAAAACTGCTCAGAAAAGTTTTCTGTTATCTGCCAGATTTCTGGTTTTAGTGATAGCCTGGTAAAAGCTGCACAAGAAGCTCATAAGGAGAATCCAGTGCCAGGCAGAGCCAATGGAGCCATATTCCTCAAACAGCCCATTGTGGGTAGAACTTATGGTGGGAATTAATGGTCGTTTNATGGGAATCGGCACAAACTGGGCTATTCACTGTCCCAAGAAAAGGGTGTTGGGGTTTTTTTGTCCAACTTTTTTTTTGGTTCAAAAGTTGGGGCCTTA
Full Trace Sequence: AGTTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGTCTGGTCAAGCAGAAGAGTTCCGACCCGTGGAACTGGGAGGGCAGGAGCTCCCTAAATCAGATGACTCGAAGAACACTGCAAGCCAGAAGGAGCAAGCGCCGGCACCTCCTAATAATACTGAGCCACATCAATTGAATGACTACCTTATGAGAAAGTATTTTGTGGCCAGGCCAGGAGCATTTGAGCAGGCCAACGAAGACTTGACAAATCAGATTTTTACAAAGGAAAATGAAACTGTGAACAGTGCCTGGCTTTTGGCAGAAGTTGATCACTGGAACAATGAGAAGGAGCGGCTTGTTCTCATCACTGATAAAAGTCTTTTCATTTGTAAATACGACTTTATCATGCTGTGCTGCCAGCAGATTCAGAAGGTTCCTCTCAATTACATTGACAAAATATGCCTTGGACCGTTCACATTCCCTCAGAGATCTCTCGACAAGAGAGAAGGCGAGGGTCTTCGAGTTCATTGGGATAAACTGCGTGAAGCCTCTTTTGCCAATCGCTGGAATCCATTTTCAGAGGCTTTACCTTACACTACTTTTATTGATCACCCCTTGAAAAACTGCTCAGAAAAGTTTTCTGTTATCTGCCAGATTTCTGGTTTTAGTGATAGCCTGGTAAAAGCTGCACAAGAAGCTCATAAGGAGAATCCAGTGCCAGGCAGAGCCAATGGAGCCATATTCCTCAAACAGCCCATTGTGGGTAGAACTTATGGTGGGAATTAATGGTCGTTTNATGGGAATCGGCACAAACTGGGCTATTCACTGTCCCAAGAAAAGGGTGTTGGGGTTTTTTTGTCCAACTTTTTTTTTGGTTCAAAAGTTGGGGCCTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGTCTGGTCAAGCAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ830173
dbEST ID: 79647875
Trimmed Sequence: AAAACCAACACTTCCTCTGGCAAGTGAATAGCCAAGTTTGTTGCGATTCCCAATAAACGACATTAATCCCACATAAGTTTCTACCACAATTGGCTGTTTGAGGAATATGGCTCCATTGGCTCTGCCTGGCACTGGATTCTCCTTATGAGCTTCTTGTGCAGCTTTTACCAGGCTATCACTAAAACCAGAAATCTGGCAGATAACAGAAAACTTTTCTGAGCAGTTTTTCAAGGGGTGATCAATAAAAGTAGTGTAAGGTAAAGCCTCTGAAAATGGATTCCAGCGATTGGCAAAAGAGGCTTCACGCAGTTTATCCCAATGAACTCGAAGACCCTCGCCTTCTCTCTTGTCGAGAGATCTCTGAGGGAATGTGAACGGTCCAAGGCATATTTTGTCAATGTAATTGAGAGGAACCTTCTGAATCTGCTGGCAGCACAGCATGATAAAGTCGTATTTACAAATGAAAAGACTTTTATCAGTGATGAGAACAAGCCGCTCCTTCTCATTGTTCCAGTGATCAACTTCTGCCAAAAGCCANGCACTGTTCACAGTTTCATTTTCCTTTGTAAAAATCTGATTTGTCAAGTCTTCGTTGGCCTGCTCAAATGCTCCTGGGCTGGCCACAAAATACTTTCTCATAAGGTAGTCATTTCAATTGATGTGGCTCATAATTATTAGGAAGGTGCCGGCGCTTTGCTCCTTCCTGCCTTTGCAGTTGTTCTTTCGAAGTCCTTCCGGATTTTAAGGGAAGCCTCCCTGGCCCT
Full Trace Sequence: GGGCACGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAACCAACACTTCCTCTGGCAAGTGAATAGCCAAGTTTGTTGCGATTCCCAATAAACGACATTAATCCCACATAAGTTTCTACCACAATTGGCTGTTTGAGGAATATGGCTCCATTGGCTCTGCCTGGCACTGGATTCTCCTTATGAGCTTCTTGTGCAGCTTTTACCAGGCTATCACTAAAACCAGAAATCTGGCAGATAACAGAAAACTTTTCTGAGCAGTTTTTCAAGGGGTGATCAATAAAAGTAGTGTAAGGTAAAGCCTCTGAAAATGGATTCCAGCGATTGGCAAAAGAGGCTTCACGCAGTTTATCCCAATGAACTCGAAGACCCTCGCCTTCTCTCTTGTCGAGAGATCTCTGAGGGAATGTGAACGGTCCAAGGCATATTTTGTCAATGTAATTGAGAGGAACCTTCTGAATCTGCTGGCAGCACAGCATGATAAAGTCGTATTTACAAATGAAAAGACTTTTATCAGTGATGAGAACAAGCCGCTCCTTCTCATTGTTCCAGTGATCAACTTCTGCCAAAAGCCANGCACTGTTCACAGTTTCATTTTCCTTTGTAAAAATCTGATTTGTCAAGTCTTCGTTGGCCTGCTCAAATGCTCCTGGGCTGGCCACAAAATACTTTCTCATAAGGTAGTCATTTCAATTGATGTGGCTCATAATTATTAGGAAGGTGCCGGCGCTTTGCTCCTTCCTGCCTTTGCAGTTGTTCTTTCGAAGTCCTTCCGGATTTTAAGGGAAGCCTCCCTGGCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAACCAACACTTCCTCTGGCAA