ORFeome > tubb ORF1 – XORFeome v1.0

tubb ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tubb
Gene ID: 864839
Gene Page ID: 482184
ORF Xenbase ID: 17302905

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC049004
Original XGC clone length: 1335

Human orthology & disease relationships

NCBI Entrez ID: 203068
Ensembl gene IDs: ENSG00000183311,ENSG00000196230,ENSG00000224156,ENSG00000227739,ENSG00000229684,ENSG00000232421,ENSG00000232575,ENSG00000235067
Directly associated (OMIM) disease MIM numbers: 615771
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11013
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ824089
dbEST ID: 79641791
Trimmed Sequence: ATGAGGGAGATCGTGCACATCCAGGCCGGCCAGTGCGGCAACCAGATCGGCGCTAAGTTCTGGGAGGTGATCAGCGATGAACATGGCATTGACCCCACTGGCACTTACCATGGAGACAGTGATCTGCAGCTTGACAGAATCAGCGTCTACTACAATGAGGCTACAGGTGGTAAATATGTCCCTCGAGCCATCCTTGTTGATCTGGAGCCAGGAACCATGGACTCTGTGCGCTCAGGACCCTTTGGACAGATTTTCAGGCCTGACAACTTTGTCTTTGGTCAAAGTGGTGCTGGCAACAACTGGGCAAAGGGCCATTACACAGAAGGTGCTGAATTGGTAGACTCTGTACTGGATGTTGTAAGAAAAGAGGCAGAGAGCTGTGACTGCCTACAGGGCTTCCAGCTCACCCACTCTCTGGGTGGTGGAACAGGGTCTGGTATGGGCACTCTTCTGATTAGTAAGATCCGTGAAGAATATCCTGACCGCATCATGAACACCTTTAGTGTTGTACCCTCTCCAAAGGTGTCTGATACAGTGGTAGAACCATACAACGCAACTCTTTCTGTTCATCAGCTGGTTGAGAACACAGATGAAACCTACTGCATTGACAATGAAGCACTCTATGACATCTGCTTCCGTACTCTNCAGCTTACCACACCAACTTACGGAGACCTCAATCATCTTGTTAGTGCTACAATGAAGTGGAGTCCTACCCTGCCCCCCTTTTCCCGGGCCAATAAAAGCGTAAACTTTTCAAAAAACCTTCCAAAAGGGGCCCCTTCCCCCGTCACCCTTTTTTTAGCCCGGGGTTTGTCCCCCCACCCAACCCCGTGGGGATCTCCCAAAACCCC
Full Trace Sequence: AATTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGGAGATCGTGCACATCCAGGCCGGCCAGTGCGGCAACCAGATCGGCGCTAAGTTCTGGGAGGTGATCAGCGATGAACATGGCATTGACCCCACTGGCACTTACCATGGAGACAGTGATCTGCAGCTTGACAGAATCAGCGTCTACTACAATGAGGCTACAGGTGGTAAATATGTCCCTCGAGCCATCCTTGTTGATCTGGAGCCAGGAACCATGGACTCTGTGCGCTCAGGACCCTTTGGACAGATTTTCAGGCCTGACAACTTTGTCTTTGGTCAAAGTGGTGCTGGCAACAACTGGGCAAAGGGCCATTACACAGAAGGTGCTGAATTGGTAGACTCTGTACTGGATGTTGTAAGAAAAGAGGCAGAGAGCTGTGACTGCCTACAGGGCTTCCAGCTCACCCACTCTCTGGGTGGTGGAACAGGGTCTGGTATGGGCACTCTTCTGATTAGTAAGATCCGTGAAGAATATCCTGACCGCATCATGAACACCTTTAGTGTTGTACCCTCTCCAAAGGTGTCTGATACAGTGGTAGAACCATACAACGCAACTCTTTCTGTTCATCAGCTGGTTGAGAACACAGATGAAACCTACTGCATTGACAATGAAGCACTCTATGACATCTGCTTCCGTACTCTNCAGCTTACCACACCAACTTACGGAGACCTCAATCATCTTGTTAGTGCTACAATGAAGTGGAGTCCTACCCTGCCCCCCTTTTCCCGGGCCAATAAAAGCGTAAACTTTTCAAAAAACCTTCCAAAAGGGGCCCCTTCCCCCGTCACCCTTTTTTTAGCCCGGGGTTTGTCCCCCCACCCAACCCCGTGGGGATCTCCCAAAACCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGGAGATCGTGCACATCCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829397
dbEST ID: 79647099
Trimmed Sequence: GGCTTCTTCTTCAGCCTCTTCATTGAAATCTTCCTCTTCTTCAGCAGTAGCATCTTGATACTGCTGATACTCTGAGACCAGATCATTCATGTTGCTCTCTGCTTCTGTGAATTCCATCTCATCCATCCCTTCTCCTGTGTACCAATGCAAGAAGGCCTTGCGACGGAACATGGCTGTAAACTGCTCTGAGATGCGTTTGAACAGCTCCTGGATGGCAGTGCTGTTACCAATGAAGGTGACTGCCATCTTAAGGCCACGGGGTGGTATGTCACATACAGCTGTCTTGACATTGTTGGGAATCCATTCAACGAAGTAGCTGCTGTTCTTGTTCTGGACATTAAGCATCTGCTCATCTACTTCTTTCATGGACATACGTCCACGGAATACAGCTGCCACTGTAAGGTACCTGCCATGGCGTGGGTCACAGGCTGCCATCATGTTTTTGGCATCAAACACCTGCTGTGTGAGCTCAGGCACTGTCAGTGCACGGTACTGCTGACTACCACGGCTAGTTAGGGGAGCAAACCCAGGCATGAAAAAGTGTAGACGTGGGAAGGGGACCATATTGACAGCTAGTTTGCGAAGATCAGCATTTAATTGGCCAAGGGAAACGAAGCAGGTAGTGACTCCACTCATTGTAGCCCTAACGAAAATGATTGAGGTCTCCGTAAGTTTGGGGTGGTAAGCTTGAAAAGTACGGGAAGCCAAATGTCATAAAAGGGCTTTATTTGTCCAAAGGCAGTAAGGGTTTCAACCTGTTTTTTTTCAAACCA
Full Trace Sequence: TGACGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCTTCTTCTTCAGCCTCTTCATTGAAATCTTCCTCTTCTTCAGCAGTAGCATCTTGATACTGCTGATACTCTGAGACCAGATCATTCATGTTGCTCTCTGCTTCTGTGAATTCCATCTCATCCATCCCTTCTCCTGTGTACCAATGCAAGAAGGCCTTGCGACGGAACATGGCTGTAAACTGCTCTGAGATGCGTTTGAACAGCTCCTGGATGGCAGTGCTGTTACCAATGAAGGTGACTGCCATCTTAAGGCCACGGGGTGGTATGTCACATACAGCTGTCTTGACATTGTTGGGAATCCATTCAACGAAGTAGCTGCTGTTCTTGTTCTGGACATTAAGCATCTGCTCATCTACTTCTTTCATGGACATACGTCCACGGAATACAGCTGCCACTGTAAGGTACCTGCCATGGCGTGGGTCACAGGCTGCCATCATGTTTTTGGCATCAAACACCTGCTGTGTGAGCTCAGGCACTGTCAGTGCACGGTACTGCTGACTACCACGGCTAGTTAGGGGAGCAAACCCAGGCATGAAAAAGTGTAGACGTGGGAAGGGGACCATATTGACAGCTAGTTTGCGAAGATCAGCATTTAATTGGCCAAGGGAAACGAAGCAGGTAGTGACTCCACTCATTGTAGCCCTAACGAAAATGATTGAGGTCTCCGTAAGTTTGGGGTGGTAAGCTTGAAAAGTACGGGAAGCCAAATGTCATAAAAGGGCTTTATTTGTCCAAAGGCAGTAAGGGTTTCAACCTGTTTTTTTTCAAACCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCTTCTTCTTCAGCCTCTT