ORFeome > tubgcp3 ORF1 – XORFeome v1.0

tubgcp3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tubgcp3
Gene ID: 866019
Gene Page ID: 490982
ORF Xenbase ID: 17302965

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC057755
Original XGC clone length: 2721

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ824682
dbEST ID: 79642384
Trimmed Sequence: ATGGCAGTTCCGGACCAAAAGTCTCCGAACGTTCTGCTGCAGAATTTGTGCTGTCGGATTCTTGGCAAGGGGGAAGCTGATGTGGCCCAGCAGTTTCAGTACGCAGTCAGAGTTATAGGCAGCAACTTTGCTCCCACCGTCGAACGAGATGAATTTCTTGTGACTGAAAAAATCAAGAAAGAATTTGTGAGACAGAGGAGGGAAGCAGACGGTGCTCTCTTTTCAGAACTTCACAGAAAGCTTCAGTCACAGGGTGTTTTGAAAAACAGATGGTCTATACTCTACCTCTTGCTTAGTCTTAGCGAAGATCCTCGGAAGCAGCCAAATAAGACCTCTAGTTTTGCTGCATTGTTTGCCCAGGCCTTGCCCCGTGATGCCCATTCCACGCCATATTATTATGCCAGGCCACAGAGCCTCCCGCTCAGTTACCAGGATCGGAATGTGCAGTGTGCACAGAATGCTGCAAGCATCGGCAGCAGTGGGATTAGTAGTATTGGCATGTATGCTTTAAATGGGCCAACACCGCAGTCCATAATTCAAGGACAGTCCAATCAAACTCCGAACATGGGAGATGCACTTCGCCAGCAGTTAGGGTCTCGCCTTGCTTGGACTTTAGCAGCTGGTCAGCAGCCATCACAGCAAAGCACTACCACCAAAGGCCTTCCCAATACAGTATCCCCAAAATGTGCAAAGGACTAGTAGAGAAGGAGACTCAAGTGGATCTGTTGAAATACAGAAACATCTTTTATGAGAGACTTTTTGTACGTTTTCCAGGAGATTTGATGGGAAAATTCCTTAAAAAGGTGCCAATTTCGGAAAAACGGG
Full Trace Sequence: CAAAATGGATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGTTCCGGACCAAAAGTCTCCGAACGTTCTGCTGCAGAATTTGTGCTGTCGGATTCTTGGCAAGGGGGAAGCTGATGTGGCCCAGCAGTTTCAGTACGCAGTCAGAGTTATAGGCAGCAACTTTGCTCCCACCGTCGAACGAGATGAATTTCTTGTGACTGAAAAAATCAAGAAAGAATTTGTGAGACAGAGGAGGGAAGCAGACGGTGCTCTCTTTTCAGAACTTCACAGAAAGCTTCAGTCACAGGGTGTTTTGAAAAACAGATGGTCTATACTCTACCTCTTGCTTAGTCTTAGCGAAGATCCTCGGAAGCAGCCAAATAAGACCTCTAGTTTTGCTGCATTGTTTGCCCAGGCCTTGCCCCGTGATGCCCATTCCACGCCATATTATTATGCCAGGCCACAGAGCCTCCCGCTCAGTTACCAGGATCGGAATGTGCAGTGTGCACAGAATGCTGCAAGCATCGGCAGCAGTGGGATTAGTAGTATTGGCATGTATGCTTTAAATGGGCCAACACCGCAGTCCATAATTCAAGGACAGTCCAATCAAACTCCGAACATGGGAGATGCACTTCGCCAGCAGTTAGGGTCTCGCCTTGCTTGGACTTTAGCAGCTGGTCAGCAGCCATCACAGCAAAGCACTACCACCAAAGGCCTTCCCAATACAGTATCCCCAAAATGTGCAAAGGACTAGTAGAGAAGGAGACTCAAGTGGATCTGTTGAAATACAGAAACATCTTTTATGAGAGACTTTTTGTACGTTTTCCAGGAGATTTGATGGGAAAATTCCTTAAAAAGGTGCCAATTTCGGAAAAACGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGTTCCGGACCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ830034
dbEST ID: 79647736
Trimmed Sequence: TACATGGAAGCTGCGCCTCCCCCTGGTTCCCATTGACACCCGTAGTCTTGGTTCTCTTGCTTTATAATGTTCATTGAAGTCCAACCTAAAGCTCAAAAATCTCAGGCTTTCATCTGTACTTGTTGTTAACAACACCAAAAACTGTTCAACGATACCCTGATAGAAATGAGTGAGAATTCTCAACTGAGAGCGCATCTTCGGTATTGATTCTTGGAATTCCTGAATCCTTTTGTTCTCTACGTCTTCTTCAGCTGCAGTAACACCCCACTCTCCCTCTGATTCTCGCTCTTTTTTCCGTTCTTCGAACTGTAGTCTCTGCTGTAACTCTTCCAACGCAGCCCTGTACAGAGCATCTTGTGCATTCTGAAACTCTATTATCTGATCAAAAACAGCCCGAAGCTGATTTAGCAAAGCTCTTGATTCACTATCAAGAAGACAGCGAGATATAATAGTGTCCAAGAAAACATCATGTGCTGCTATGATGTGATCCAAGTCTTGTGCTTTCAGCACCTTGTTCCAAAGCTCATCCCATGAGCATTCCAGGACCTCAAATGTGATATAATACTGCATCTGATGAATGAAATGGACCATTTCTGAAGCCAGTATGTGACACTGATGAAGGACCCCAGAGAGCTCTGGCATGCCTTTGAGTTATTTTGCATTGCACATATGTCCTTTCCATATTGTCTGTGAAGTATATACTCCATCCTTCCTTGCCCGGCCCAGAGGAAATTTAAAAACCCCCCTTGAGGTAAATGAAACTCAAAC
Full Trace Sequence: ACGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACATGGAAGCTGCGCCTCCCCCTGGTTCCCATTGACACCCGTAGTCTTGGTTCTCTTGCTTTATAATGTTCATTGAAGTCCAACCTAAAGCTCAAAAATCTCAGGCTTTCATCTGTACTTGTTGTTAACAACACCAAAAACTGTTCAACGATACCCTGATAGAAATGAGTGAGAATTCTCAACTGAGAGCGCATCTTCGGTATTGATTCTTGGAATTCCTGAATCCTTTTGTTCTCTACGTCTTCTTCAGCTGCAGTAACACCCCACTCTCCCTCTGATTCTCGCTCTTTTTTCCGTTCTTCGAACTGTAGTCTCTGCTGTAACTCTTCCAACGCAGCCCTGTACAGAGCATCTTGTGCATTCTGAAACTCTATTATCTGATCAAAAACAGCCCGAAGCTGATTTAGCAAAGCTCTTGATTCACTATCAAGAAGACAGCGAGATATAATAGTGTCCAAGAAAACATCATGTGCTGCTATGATGTGATCCAAGTCTTGTGCTTTCAGCACCTTGTTCCAAAGCTCATCCCATGAGCATTCCAGGACCTCAAATGTGATATAATACTGCATCTGATGAATGAAATGGACCATTTCTGAAGCCAGTATGTGACACTGATGAAGGACCCCAGAGAGCTCTGGCATGCCTTTGAGTTATTTTGCATTGCACATATGTCCTTTCCATATTGTCTGTGAAGTATATACTCCATCCTTCCTTGCCCGGCCCAGAGGAAATTTAAAAACCCCCCTTGAGGTAAATGAAACTCAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACATGGAAGCTGCGCCT