ORFeome > zdhhc16 ORF1 – XORFeome v1.0

zdhhc16 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: zdhhc16
Gene ID: 6078138
Gene Page ID: 957763
ORF Xenbase ID: 17305557

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC110951
Original XGC clone length: 1059

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ837694
dbEST ID: 79655396
Trimmed Sequence: ATGAGAAGCAGTCAGCGCCTGTTCCGTAGGTGCCTACATTTGGGTCACCGGAGGAGATTTAGGTTTGCGACCAAACTGATTGATTATATAAGATATGCAAGGTTCTGCGTTGTTTCTCTTGCCTACAATTCGTTCACCAACAGTGATGTTGTCATTGAATCACTCTTTGAGCCCGTTTACTGGCTTGTGGACCATGTGACTAGGTGGTTTGGCATTGTGTTTGTGGCTCTGGTTATTGTTCTGACAAGCTCTATAGTGTTGATTGTGTACATCTGCGTCCTGCCCCTTATTATTCAGACGTACTCTACCGCTTGGATCTACTGGCATGTCTCCTATGGGCACTGGAATCTCATCATGATTGTCTTTCATTATTACAAGGCAACTACTACACCCCCTGGACATCCTTCACAAATGGAGACAGACATACCATCCGTGTCTATCTGTAGGAAATGTATAGCACATAAACCTGCCCGTACCCATCACTGTAGCATCTGTAGCAGGTGTGTACTGAAAATGGATCATCATTGCCCCTGGTTGAACAACTGCGTGGGGCATTACAACCATTGCTATTTCTTCTCATTTTGCCTATTTATGACCATGGGAATGCTTTACTGCAGTATCAGTATTCCAGTCGTGTTGCGGTGAAGCTTAGAGCCCTTTAGAGAACTACAAATGAAAAT
Full Trace Sequence: CGAGGGCCCATATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGAAGCAGTCAGCGCCTGTTCCGTAGGTGCCTACATTTGGGTCACCGGAGGAGATTTAGGTTTGCGACCAAACTGATTGATTATATAAGATATGCAAGGTTCTGCGTTGTTTCTCTTGCCTACAATTCGTTCACCAACAGTGATGTTGTCATTGAATCACTCTTTGAGCCCGTTTACTGGCTTGTGGACCATGTGACTAGGTGGTTTGGCATTGTGTTTGTGGCTCTGGTTATTGTTCTGACAAGCTCTATAGTGTTGATTGTGTACATCTGCGTCCTGCCCCTTATTATTCAGACGTACTCTACCGCTTGGATCTACTGGCATGTCTCCTATGGGCACTGGAATCTCATCATGATTGTCTTTCATTATTACAAGGCAACTACTACACCCCCTGGACATCCTTCACAAATGGAGACAGACATACCATCCGTGTCTATCTGTAGGAAATGTATAGCACATAAACCTGCCCGTACCCATCACTGTAGCATCTGTAGCAGGTGTGTACTGAAAATGGATCATCATTGCCCCTGGTTGAACAACTGCGTGGGGCATTACAACCATTGCTATTTCTTCTCATTTTGCCTATTTATGACCATGGGAATGCTTTACTGCAGTATCAGTATTCCAGTCGTGTTGCGGTGAAGCTTAGAGCCCTTTAGAGAACTACAAATGAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGAAGCAGTCAGCGCCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837693
dbEST ID: 79655395
Trimmed Sequence: TATATCAAGGACACACGGCTGCTGATTGAGTATCCAGGGTGGAGCATTCCAGGTTAAACCTTTCCCAAAAGGCAGGTGTGAAGATGGTAGAGCAACTCTGGTTAACCAGTGCAGTTTTCTCTCTACTCCAAAGAAAACTTTCCAGTTTCCACACCGACCATAGCTATAGGGATTATAAAATACCTTGCCAATCAATTGCTGCCTCTTCCTTTCCTTTTTGTTGATGTGCCTCTCTATACTGGTCTCACCCCGACTGATCAGCATGGCATGCCACAGAGTCAGTGCGCCCAAAGCCAGTGCTACAGAGCTGCAGAGTACCCAGAGGTATATGATGCACTTGTGAAACAATCTCTCTCTGAATGTAAAGGTTGGGGGTGGAGTCTCATTGTAGGTCTCTATAGCGCTGTAAGCTTCACGGAACATGACTCGACTACTGATACTGCAGTAAATGCATCCCATGGTCGTAAATAGGCAAAATGAGAAGAAATAGCGATGGTTGTAATGCCCCACACGATTGTTCAACCAGGGGCGATGATGATCCATTTTTCATACACACCTGCTGCAGATGGCTACGGTGATGGGTACGGGCAGGTTTATGTATCGAAGCTTTCCTACACATAGACACGGCAGGGTGAGGGGGTCGCCGCTTGGGAGTAAGGTGAGGGGGTGGTGGTAGTTGTCTTGTAGTGGTGAGAAAGGGCATGGGAAAGAGTCGGCTGCCATGAGGGAAGGGGGGGGAGAATCGGAGCGGGGGGAGGAGTCGGAAAAAAGAGGAGGGGGAAGGGGGAGGTAGACAGCCCGACCATATAAGAGTTTTGGAGAGGGTGAGGAGAAAGCGCGGGCCGCAGAGCTGGCGGGACCGGGGAGCGGGGTGGGGAGGGGGGAGAAGGGGGGGTGAGAAAAGAATTGGAAAGGAAAGGAGAGCTGGTGGGGAGAAGAAGATGGATGGCAAAAAAAGGAAAGCGGCGGAAGCGAAACGGAGGCTGAGAGAGTTAGGAGGGTGTGTGACGGGAAGACCAAGAGCGCGTGACGGAGGGAGGAGGGTGGGAGGGAGGCGCACAGAAGACAGAGCATACGATGTTGTG
Full Trace Sequence: GGGCAGGGGAACAGCTTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATATCAAGGACACACGGCTGCTGATTGAGTATCCAGGGTGGAGCATTCCAGGTTAAACCTTTCCCAAAAGGCAGGTGTGAAGATGGTAGAGCAACTCTGGTTAACCAGTGCAGTTTTCTCTCTACTCCAAAGAAAACTTTCCAGTTTCCACACCGACCATAGCTATAGGGATTATAAAATACCTTGCCAATCAATTGCTGCCTCTTCCTTTCCTTTTTGTTGATGTGCCTCTCTATACTGGTCTCACCCCGACTGATCAGCATGGCATGCCACAGAGTCAGTGCGCCCAAAGCCAGTGCTACAGAGCTGCAGAGTACCCAGAGGTATATGATGCACTTGTGAAACAATCTCTCTCTGAATGTAAAGGTTGGGGGTGGAGTCTCATTGTAGGTCTCTATAGCGCTGTAAGCTTCACGGAACATGACTCGACTACTGATACTGCAGTAAATGCATCCCATGGTCGTAAATAGGCAAAATGAGAAGAAATAGCGATGGTTGTAATGCCCCACACGATTGTTCAACCAGGGGCGATGATGATCCATTTTTCATACACACCTGCTGCAGATGGCTACGGTGATGGGTACGGGCAGGTTTATGTATCGAAGCTTTCCTACACATAGACACGGCAGGGTGAGGGGGTCGCCGCTTGGGAGTAAGGTGAGGGGGTGGTGGTAGTTGTCTTGTAGTGGTGAGAAAGGGCATGGGAAAGAGTCGGCTGCCATGAGGGAAGGGGGGGGAGAATCGGAGCGGGGGGAGGAGTCGGAAAAAAGAGGAGGGGGAAGGGGGAGGTAGACAGCCCGACCATATAAGAGTTTTGGAGAGGGTGAGGAGAAAGCGCGGGCCGCAGAGCTGGCGGGACCGGGGAGCGGGGTGGGGAGGGGGGAGAAGGGGGGGTGAGAAAAGAATTGGAAAGGAAAGGAGAGCTGGTGGGGAGAAGAAGATGGATGGCAAAAAAAGGAAAGCGGCGGAAGCGAAACGGAGGCTGAGAGAGTTAGGAGGGTGTGTGACGGGAAGACCAAGAGCGCGTGACGGAGGGAGGAGGGTGGGAGGGAGGCGCACAGAAGACAGAGCATACGATGTTGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATATCAAGGACACACGGCT