ORFeome > acads – XORFeome 2.0

acads – XORFeome 2.0

General Information

Species: Xenopus tropicalis acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain, mRNA (cDNA clone MGC:76107 IMAGE:5308577), complete cds
Gene Symbol: acads
Gene ID: 394882
ORF gb_acc: MG132721
ORF ID: 10017

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064210

Library Location

Plate ID: GDExt11001
Well Location: F08

EST Sequences

Clone: MGC:76107 IMAGE:5308577
Trimmed Sequence: ATGCTGCGCGGAAGTGTTTTGCTGGGCCTGTGCCACAGGGCCGCCCGGGCGGCGCTCCGGCCCTTGCACACGGTGTATCAGACTGCAGAACTGCCGGAAACTCACCAGATGTTGCGCGACACTTGTAGGGAATTTGCAGAAAAGGAGCTGCAGCCGATAGCAGCCGGGCTGGACCGGGAGCATCGATTTCCCCGGGATCAGGTCCGACAGATGGGGCAGATAGGACTGCTGGCAGTTGAGGTCCCAGAGGAGCTTGGAGGGGCCGGACTTGATTATCTGGCATATTCAATCGCAGTGGAAGAGATCAGCCGTGGGTGTGCATCTACAGGGGTCATTATGAGTGTAAATAATTCTCTTTATTTAGGTCCTATCCTTAAACATGGTTCAGAAGAACAAAAAAGACAATGGATTTCTCCATTTTGCAGTGGAGATAAAATTGGTTGTTTTGCTCTCAGCGAGCCAGGTAATGGCAGCGATGCTGGTGCTGCAAGTACGACTGCAAAGTTGGATGGAGAGGAGTGGGTTTTAAATGGCACCAAATCCTGGATCACAAATGCTTGGGATGCTTCTGCAGCTGTTGTGTTGGCAACCACAGACAAAAGCCTAAAACACAAGGGCATCAGTGCTTTCTTAGTGGAGATGCCAACTCCAGGTCTGTCTCTAGGAAAGAAGGAAGATAAACTGGGTATCAGAGCTTCCTCCACTGCAAATTTAATATTTGAAGACTGCCGCATCCCAAGGCAGAATCTCCTAGGCCAACCAGGAATGGGCTTTAAAATTGCAATGCAAACCTTGGATGCTGGCAGGATTGGTATTGCATCTCAGGCACTTGGGATAGGACAGGCAGCACTAGACTGTGCCGTAGACTATGCAGAAAAACGCCTTGCATTTGGAGCCCCCATCAGTAAATTGCAAGCAATACAGTTTAAGTTGGCAGACATGGCGTTGGCACTAGAGAGTGCTCGGCTGTTGACCTGGAGAGCAGCCATGATGAAGGATAACAAGAAGCCCTTCACTAAAGAAGCAGCAATGGCAAAACTCGCAGCCTCTGAGGCAGCTACACAAATCTCTCATCAGGCCATCCAGATACTAGGAGGAATGGGCTATGTAAGTGATATGCCTGCCGAGCGCCATTACAGAGATGCAAGAATTACAGAAATCTATGAGGGCACAAGTGAGATCCAGCGACTGGTGATAGCCAATCAGCTTCTGAAAGAATACCGCAGTTGA
Full Trace Sequence: gagaaagttctgctcagtgggaagaaaccgggtcgggatgctgcgcggaagtgttttgctgggcctgtgccacagggccgcccgggcggcgctccggcccttgcacacggtgtatcagactgcagaactgccggaaactcaccagatgttgcgcgacacttgtagggaatttgcagaaaaggagctgcagccgatagcagccgggctggaccgggagcatcgatttccccgggatcaggtccgacagatggggcagataggactgctggcagttgaggtcccagaggagcttggaggggccggacttgattatctggcatattcaatcgcagtggaagagatcagccgtgggtgtgcatctacaggggtcattatgagtgtaaataattctctttatttaggtcctatccttaaacatggttcagaagaacaaaaaagacaatggatttctccattttgcagtggagataaaattggttgttttgctctcagcgagccaggtaatggcagcgatgctggtgctgcaagtacgactgcaaagttggatggagaggagtgggttttaaatggcaccaaatcctggatcacaaatgcttgggatgcttctgcagctgttgtgttggcaaccacagacaaaagcctaaaacacaagggcatcagtgctttcttagtggagatgccaactccaggtctgtctctaggaaagaaggaagataaactgggtatcagagcttcctccactgcaaatttaatatttgaagactgccgcatcccaaggcagaatctcctaggccaaccaggaatgggctttaaaattgcaatgcaaaccttggatgctggcaggattggtattgcatctcaggcacttgggataggacaggcagcactagactgtgccgtagactatgcagaaaaacgccttgcatttggagcccccatcagtaaattgcaagcaatacagtttaagttggcagacatggcgttggcactagagagtgctcggctgttgacctggagagcagccatgatgaaggataacaagaagcccttcactaaagaagcagcaatggcaaaactcgcagcctctgaggcagctacacaaatctctcatcaggccatccagatactaggaggaatgggctatgtaagtgatatgcctgccgagcgccattacagagatgcaagaattacagaaatctatgagggcacaagtgagatccagcgactggtgatagccaatcagcttctgaaagaataccgcagttgattttctgctatataatgtgcctggtggctttctatgcctgaagtttaagccctgagctgagaaaaatcagcagctgcaggattttataccactgtgcctaagtgatattggccacacgagcatcaaaaatctaacagacctttagtttggtttttccgctcctgtttgcctaattaataccagcatggcataagggcctacatcagcaccacaatagaatatggattttttttctgctgtgcatctggcaggttcaggctgtggaagtcgatgtggaaatggggaaacatgtagccaataaatgaagcgatcttcatttaataatccattcagaccaggcatcccaaacctgctctaatgtgcaatctatggaataaaattttgtaccaatgctctgtttgactggctgctgttataaatttaactgcggcacactatggaacactggaggtaagctgttttggttaataccaacaaactataaatgacaaaccagctcaatgttatagtttactgcttagaatctgacagtgcatcaaacaatgcattgctttacacatgtctactctctacctcagtgccattgtattgggcaaaataccatagaggcttatgtggcttgtagccctgtataactataacacacagtaacaaatgagagaggctgtggatgcaaggagcactttagacagtgaatgagggtatcttgtgtagtggagttgctatgtgttacctgtataagagttctattattaaagaccttcatataaaaaatgaaattaaaaaaaaaaaaaaaaa
Translation: MLRGSVLLGLCHRAARAALRPLHTVYQTAELPETHQMLRDTCREFAEKELQPIAAGLDREHRFPRDQVRQMGQIGLLAVEVPEELGGAGLDYLAYSIAVEEISRGCASTGVIMSVNNSLYLGPILKHGSEEQKRQWISPFCSGDKIGCFALSEPGNGSDAGAASTTAKLDGEEWVLNGTKSWITNAWDASAAVVLATTDKSLKHKGISAFLVEMPTPGLSLGKKEDKLGIRASSTANLIFEDCRIPRQNLLGQPGMGFKIAMQTLDAGRIGIASQALGIGQAALDCAVDYAEKRLAFGAPISKLQAIQFKLADMALALESARLLTWRAAMMKDNKKPFTKEAAMAKLAASEAATQISHQAIQILGGMGYVSDMPAERHYRDARITEIYEGTSEIQRLVIANQLLKEYRS
Donor tissue: gastrula