ORFeome > acbd5 – XORFeome 2.0

acbd5 – XORFeome 2.0

General Information

Species: Xenopus tropicalis acbd5 protein, mRNA (cDNA clone MGC:89100 IMAGE:7006466), complete cds
Gene Symbol: acbd5
Gene ID: 493542
ORF gb_acc: MG134085
ORF ID: 11709

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC082499

Library Location

Plate ID: GDExt11017
Well Location: D07

EST Sequences

Clone: MGC:89100 IMAGE:7006466
Trimmed Sequence: ATGGCGGACACCAAACCTCTTCACCAGACACGATTTGAAGCAGCAGTCAGCGTGATACAGAGTTTGCCCAAAAATGGTTCATTCCAGCCTTCTAATGAAATGATGCTGAAGTTCTATAGCTTCTATAAGCAGGCAACCTTAGGACCATGTAATACTCCAAGACCTGGATTTTGGGATCCTGTTGGGCGATACAAGTGGGATGCCTGGAATTCCCTAGGGGACATGTCCAAAGAAGATGCTATGATTGCTTATGTGGATGAAATGAAAAAGATCCTTGAGACTATGCCAGTGACGGAAAAAGTGGAAGAATTGCTTCAAGTCATAGGTCCGTTTTATGAAATAGTGGAAGACAAAAAACATGGGCGAGGATCTGGTGTGACATCAGAACTTGGCAGTGTCCTGACATCTACACCAAATGGCAAGGCAGTGAATGGCAAGGCAGAGAGCAGTGACAGCGGCGCAGAGTCAGATGAAGAACAGGCAGCAACAAAGGAAGTTAGGGAGGAAGATGAAGAAGAGGAAAGTGAGCATAGCGAGCAAGAAGACAAAGATGTGGAACAGCAGCCTGGACACGAGAAGCCTGCAGAGAGTATTGTTAATGGTTTAACCAGAAACCACAGAGAGTTGGTAACAGAGGAGCCAACTCCCCTCCCTTCCAAATGTCTCAGTGAGCCAGGAGATAAGGTGGCCATTCCGGACACACACAGTCCTGTGAATGATCCTGAAGCAGACAGAGAAGAAGACTGCACAGAGGATATTGCTGCAATGCAGCATCTGACAAGTGACTCAGACAGTGAGATTTTCTGTGACTCAATGGAACAGTTTGGGCAAGATGAGGCTGACCACAGTCTGCTTCTCCAAGATGCAATGTTAAATGGGGACATAACAGAAACGTCAGCTGGAGGAGAGCTTAAAGATGGGGGAGAGGATGGAAAGCAGTCTGGTCATGGAGCACAGAGAAAAACATGGAGTGAAAAGTCTGAGCATTTCGGTTCCAGAAGAGAAAGACCTAGTCGCATGCAGCCTGGGGGTGATGGATCAAGAAGTGGACAGATAGGCAGTGGTGGAGATGGAGACCGCTGGGGGTCAGACAGAGGACCAAATGGGAGCCTGAATGAACAGATTGCTGTTGTGCTAATGCGGCTACAGGAGGACATGCAGAACGTGCTGCAAAGGCTTCACTCTCTAGAAGTCCAGACTGCATCTCAGGCACAGTTTCTGCTTCGGGAATCTAATAATCAACCCATGGAAAAGAAACCATCAAGGTGGCCTTTTGGGATCTCACCTGGCACATTGGCACTGGCAGTTGTCTGGCCATTTGTAGTTCATTGGCTAATGCATGTATTCCTTCAGAAGAGGAGGAGAAAGCAAACCTGA
Full Trace Sequence: gtgatggctcctgggctgctgcaggtggaatgagaggtgaccgagcccttcccgcactccttactctgtgacccgcacgaataacccctgacttctgagtgcctgggactcccctaaccatggcagactggcggcgcaggtttaagctttgttggtagaagcattgttttgaccctttcaaaaacgacaacatggcggacaccaaacctcttcaccagacacgatttgaagcagcagtcagcgtgatacagagtttgcccaaaaatggttcattccagccttctaatgaaatgatgctgaagttctatagcttctataagcaggcaaccttaggaccatgtaatactccaagacctggattttgggatcctgttgggcgatacaagtgggatgcctggaattccctaggggacatgtccaaagaagatgctatgattgcttatgtggatgaaatgaaaaagatccttgagactatgccagtgacggaaaaagtggaagaattgcttcaagtcataggtccgttttatgaaatagtggaagacaaaaaacatgggcgaggatctggtgtgacatcagaacttggcagtgtcctgacatctacaccaaatggcaaggcagtgaatggcaaggcagagagcagtgacagcggcgcagagtcagatgaagaacaggcagcaacaaaggaagttagggaggaagatgaagaagaggaaagtgagcatagcgagcaagaagacaaagatgtggaacagcagcctggacacgagaagcctgcagagagtattgttaatggtttaaccagaaaccacagagagttggtaacagaggagccaactcccctcccttccaaatgtctcagtgagccaggagataaggtggccattccggacacacacagtcctgtgaatgatcctgaagcagacagagaagaagactgcacagaggatattgctgcaatgcagcatctgacaagtgactcagacagtgagattttctgtgactcaatggaacagtttgggcaagatgaggctgaccacagtctgcttctccaagatgcaatgttaaatggggacataacagaaacgtcagctggaggagagcttaaagatgggggagaggatggaaagcagtctggtcatggagcacagagaaaaacatggagtgaaaagtctgagcatttcggttccagaagagaaagacctagtcgcatgcagcctgggggtgatggatcaagaagtggacagataggcagtggtggagatggagaccgctgggggtcagacagaggaccaaatgggagcctgaatgaacagattgctgttgtgctaatgcggctacaggaggacatgcagaacgtgctgcaaaggcttcactctctagaagtccagactgcatctcaggcacagtttctgcttcgggaatctaataatcaacccatggaaaagaaaccatcaaggtggccttttgggatctcacctggcacattggcactggcagttgtctggccatttgtagttcattggctaatgcatgtattccttcagaagaggaggagaaagcaaacctgactgtgctcctgaaacctactggtaccctaaagcctagcggggatgccctcctattgtctcagcttggccggctgtggctcgaagatcatcttcttctatctgctctagtaaattccttgcactacatgaatgatgataacctaataaggactaattgtactaaagctcgaatactggaaatacataggaagccacactgaagtgaatgaaacctaaattatttttatctaaggatagcatgtaatagatctaattgcctaacggttacagaatgggttgaatgagtttggcacgatacagacatgtataataaacactgtaagcttaggagctgtatttttaaccaaataaagactttatttggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MADTKPLHQTRFEAAVSVIQSLPKNGSFQPSNEMMLKFYSFYKQATLGPCNTPRPGFWDPVGRYKWDAWNSLGDMSKEDAMIAYVDEMKKILETMPVTEKVEELLQVIGPFYEIVEDKKHGRGSGVTSELGSVLTSTPNGKAVNGKAESSDSGAESDEEQAATKEVREEDEEEESEHSEQEDKDVEQQPGHEKPAESIVNGLTRNHRELVTEEPTPLPSKCLSEPGDKVAIPDTHSPVNDPEADREEDCTEDIAAMQHLTSDSDSEIFCDSMEQFGQDEADHSLLLQDAMLNGDITETSAGGELKDGGEDGKQSGHGAQRKTWSEKSEHFGSRRERPSRMQPGGDGSRSGQIGSGGDGDRWGSDRGPNGSLNEQIAVVLMRLQEDMQNVLQRLHSLEVQTASQAQFLLRESNNQPMEKKPSRWPFGISPGTLALAVVWPFVVHWLMHVFLQKRRRKQT
Donor tissue: