ORFeome > actb – XORFeome 2.0

actb – XORFeome 2.0

General Information

Species: Xenopus tropicalis actin, beta, mRNA (cDNA clone MGC:76228 IMAGE:5336483), complete cds
Gene Symbol: actb
Gene ID: 407952
ORF gb_acc: MG133441
ORF ID: 10958

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC068217

Library Location

Plate ID: GDExt11009
Well Location: E06

EST Sequences

Clone: MGC:76228 IMAGE:5336483
Trimmed Sequence: ATGGACGACGATATTGCTGCACTGGTCGTTGACAATGGTTCTGGTATGTGCAAAGCCGGCTTTGCAGGTGATGATGCACCCCGTGCTGTTTTCCCATCCATTGTTGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAGAAAGATAGCTACGTAGGAGACGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCTATTGAGCATGGCATTGTCACTAACTGGGATGATATGGAGAAGATCTGGCATCATACCTTCTACAATGAACTCAGAGTGGCCCCAGAGGAACACCCAGTGCTGCTGACAGAAGCACCCTTGAATCCCAAAGCTAACCGGGAGAAAATGACGCAGATCATGTTTGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACACACACTGTGCCAATATATGAAGGTTATGCTCTACCCCATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTCACTGAGAGGGGGTACAGCTTCACCACCACAGCTGAAAGAGAAATTGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCTTCTTCTTCATCATTGGAAAAGAGTTATGAGCTGCCTGATGGACAAGTTATCACCATTGGTAATGAGCGGTTTAGATGTCCAGAAGCACTCTTCCAGCCTTCTTTCCTTGGTATGGAATCCTGTGGCATTCATGAAACCACTTACAACTCAATTATGAAGTGTGATGTAGATATCCGTAAGGACCTCTATGCCAATACTGTTCTCTCTGGTGGAACCACAATGTACCCTGGAATTGCTGATAGAATGCAGAAAGAAATAACTGCACTAGCTCCCAGCACCATGAAAATCAAGATAATTGCTCCCCCTGAGCGTAAATACTCTGTCTGGATTGGCGGTTCCATCTTGGCTTCCCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGATGAGTCTGGGCCCTCAATAGTGCATCGTAAATGCTTCTAA
Full Trace Sequence: ggacagtgtgtgtgtcgtactctcagattacaatggacgacgatattgctgcactggtcgttgacaatggttctggtatgtgcaaagccggctttgcaggtgatgatgcaccccgtgctgttttcccatccattgttggtcgcccaagacatcagggtgtcatggttggaatgggacagaaagatagctacgtaggagacgaagctcaaagcaaaagaggtattcttacactcaaatatcctattgagcatggcattgtcactaactgggatgatatggagaagatctggcatcataccttctacaatgaactcagagtggccccagaggaacacccagtgctgctgacagaagcacccttgaatcccaaagctaaccgggagaaaatgacgcagatcatgtttgagacctttaacactccagctatgtatgttgccatccaagctgtgttgtccctgtatgcatctggtcgtaccactggtattgtcatggactcaggtgatggtgtaacacacactgtgccaatatatgaaggttatgctctaccccatgccattctgcgtctggacttggctggacgtgacctgacagactacctcatgaaaatcctcactgagagggggtacagcttcaccaccacagctgaaagagaaattgttcgtgatatcaaggagaaattgtgctatgttgctctggactttgagcaggagatggccacagctgcttcttcttcatcattggaaaagagttatgagctgcctgatggacaagttatcaccattggtaatgagcggtttagatgtccagaagcactcttccagccttctttccttggtatggaatcctgtggcattcatgaaaccacttacaactcaattatgaagtgtgatgtagatatccgtaaggacctctatgccaatactgttctctctggtggaaccacaatgtaccctggaattgctgatagaatgcagaaagaaataactgcactagctcccagcaccatgaaaatcaagataattgctccccctgagcgtaaatactctgtctggattggcggttccatcttggcttccctgtccaccttccagcagatgtggatcagcaagcaggagtatgatgagtctgggccctcaatagtgcatcgtaaatgcttctaaaaggacggaccctttcaacgtgaacaaatgtacctgtgcaggaagataacattggcatggcttttctttcattggcgcttggctcagatttgataactggaatgaacaaatagcactgtatggtcatcaatgcagaggacattatgattttattcagtcaatagtattgtattgaggaagctaccctttcaatgttgcccagcttggtgggaagctcatacagaaatcatggtgatactattgtgttttttgatttttttttttttttgttttttttcttgtgcagctatgtacccaaacatgtctctgtatcttctgccttgaacacttgtaacttgtttaacccaaaaaagggcatcattctctaacacctggaaggtttacattatcattgatcacataagatgtgacgggtcacctgtaacctaactgaaaaaaataaaaccaagttgtttcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDDDIAALVVDNGSGMCKAGFAGDDAPRAVFPSIVGRPRHQGVMVGMGQKDSYVGDEAQSKRGILTLKYPIEHGIVTNWDDMEKIWHHTFYNELRVAPEEHPVLLTEAPLNPKANREKMTQIMFETFNTPAMYVAIQAVLSLYASGRTTGIVMDSGDGVTHTVPIYEGYALPHAILRLDLAGRDLTDYLMKILTERGYSFTTTAEREIVRDIKEKLCYVALDFEQEMATAASSSSLEKSYELPDGQVITIGNERFRCPEALFQPSFLGMESCGIHETTYNSIMKCDVDIRKDLYANTVLSGGTTMYPGIADRMQKEITALAPSTMKIKIIAPPERKYSVWIGGSILASLSTFQQMWISKQEYDESGPSIVHRKCF
Donor tissue: tailbud