ORFeome > adamts9 – XORFeome 2.0

adamts9 – XORFeome 2.0

General Information

Species: Xenopus tropicalis adamts9 protein, mRNA (cDNA clone MGC:79550 IMAGE:6978291), complete cds
Gene Symbol: adamts9
Gene ID: 493280
ORF gb_acc:
ORF ID: 11210

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080332

Library Location

Plate ID: GDExt11011
Well Location: H05

EST Sequences

Clone: MGC:79550 IMAGE:6978291
Trimmed Sequence: ATGCACTTCAAGAGGACGAGGAGGAGTGTCCCTAACAGTCGTGACATTGACCCTTGGGCCGCCTCTAGGACTCATTACAAACTGTCAGCCTTCGGCCAGCACTTTTTTCTCAATCTGACTGCCAATTCTGGATTTATGGCACCGGTTTTTACCGTTAGCCTGCATGGGAAACCCAGGGGCAACCAAAGCAGCTACTACACGGACAACACTGACTTTCAGCACTGCTTTTTCAATGGGCATGTGAATCACAGGGCAGAGCATACGGCAGTCATCAGCCTTTGTTCAGGGATGCTAGGCACATTCAAGTCTCAGGACGGGGACTATTTCGTAGAACCGTTACTCTCCGACGACAGTGAATATGAAGAAGAACACAACAAGCCACACGTCGTCTACAGACACAACCCACCTCACAGAAACATCTCAAGGGAAGAGCAGACGTGCCACACCGCAGAGCCAACGCACGCGTCAGACTCACACGCAAAGGGAGGCGCCCGACTGGAACAAAATGACCCCCATTCAGATGACCAGGCCTTGAATAAGGGCTTGTTAGGAACCCAGAACCCCCTATTCAATAAAGCAGATAACGCCACTGGGACCCGGACCTTGCGAAGGAAAAAGCGCTTCCTGTCTTACCCTCGGTACGTGGAAGTGATGGTGGTGGCTGACAACAAGATGGTTGAATATCACGGCGCTAATCTGCAGCATTACGTTCTGACTCTCATGTCCATAGTAGCTTCTATTTATAAGGATCCGAGCATTGGGAATTTAATTAATATTGCCATAGTGAAGTTAGCAGTGGTCCATGATGAACAGGAGGGCCCGGCCATCTCATTCAATGCCCAAAGCACTTTGAAAAACTTTTGCATATGGCAGCAATCGCAGAACAACCCGGACGACAATCATCCGTCGCACCACGATACCGCCGTGCTCATCACTCGACAGGATATTTGTAAGGCGCAAGAAAAATGCGACACTTTGGGCCTGGCCGAACTGGGCACCGTGTGTGACCCCTACCGGAGCTGCTCCATCAGTGAAGACAACGGGCTCAGCACGGCATTTACTATAGCACATGAGCTTGGACACGTATTCAACATGCCGCACGACGACAGCAACAAATGCAAAGAGGAAAGCGGCAAAAACCAGCAGCACGTCATGGCGCCGACCCTTAACTTCTACACCAACCCCTGGATGTGGTCAAAGTGCAGCCGGAAATACGTCACGCAGTTTCTAGACACGGGTTACGGGGAGTGCCTGCTGGATGAGCCAATCTCTAGAACATACACACTGCCTCAGCAGCTACCGGGGGCTTTGTACAATGTCAATAAGCAATGTGAATTGATATTTGGACCGGGATCCCAGGTGTGCCCGTATATGCAAATGCAGTGCCGGCGACTGTGGTGCATCAGCAGCGATGGGCAACACAAGGGCTGCCGGACCCAACACACGCCGTGGGCAGATGGCACCGAATGTGAGCCGGGGAAGCACTGCAGATACGGAGTATGTATTCCTAAAGAACGGGACGTACAGATTGCAGATGGATCTTGGGGGTCCTGGAGTCCATTCGGAGCCTGCTCTCGGTCATGTGGTGGTGGGATAAAAACTTCCATCCGTGAATGCAATAGACCCGAACCAAAAAATGGTGGTAAATACTGTGTTGGGCGTAGAATGAAGTTTAAATCCTGCAATACGGAGCTGTGCGCCAAACACAAGAGAGACTTCAGAGAGGAGCAGTGCGCGGATTTCGACGGGAAGCATTTTAATATTAATGGTCTACCTCCAAATGTGCGCTGGGTGCCCAAATACAGCGGCATTTTAATGAAAGACCGCTGCAAGCTCTTCTGCCGAGTAGCGGGGAGCACGGCTTATTATCAGCTCAGGGACAGAGTGGTGGATGGGACGTCGTGTGGGCCGGACACTAACGATATCTGCGTGCAAGGACTGTGTCGGCAAGCTGGATGCGACCATGTCCTAAACTCAAAGGCCAGAAGGGACAAGTGCGGTGTTTGTGGGGGAGACAATTCATCCTGTAAAACAATTGCTGGAACATATAATATAGTGCATTACGGCTACAACTCCGTGGTTCGCATTCCAGCTGGTGCTACTAACCTTGACGTTCGACAACACAGCTACTCAGGGAAGCCAGAAGATGACAATTACCTTGCTTTGTCGAACAGTCATGGAGAATTTCTTTTAAATGGAGACTTTGTGGTCAGTATGTTCAAAAGGGAAATCAAAGTGGGAAATGCGGTGATTGAATATAGCGGGTCGGACAATGCCATCGAAAGGATTAACTGCACGGATCGCATTGAGCAGGAAATCGTTCTCCAGATCCTGTCAGTTGGTAATTTATATAATCCAGACGTGCGGTATACTTTTAATATTCCAATTGAAGATAAACCTCAGCAGTTTTACTGGAATCCATACGGGCCTTGGCAGCCCTGCAACAAAATGTGCCAAGGGGAACGAAAGCAGAAACCAGTATGTATCCGGGATTCTGACCAGCTAGTTGTTTCGGATCAGAGATGTGATCGGATCCCTCAGCCAGAGCCAGTAACAGAGCCATGTAACACTGAATGTGAAGTGGCACGTGGCCAGGAAGAGTGA
Full Trace Sequence: caaagctcccggttagtctccagtgaaggcagcagggaagcagcaaatgggagtcgggctgagtgggtgggtgccagggcgctatgctggagcgcttgccgtgcccattgctgcccaatgttcgctccgagccgccgctgaatgctgaatcccgggagagctcaggctgccggatccggaccgtagggcaccgctcggtgcagagagggagtgcggccgggggggtgtaaaggggacaaacatgcatcttgcctcccggctgctgggactagtgattctcctgcgggactgcgcgtatggagcggcgccactgagggctccccggctctacccaagccaagttcctagagaagctgggggcttacgagatagtgacccccaccagagtgaatgagcttggagaagcctttcccagcaacatgcacttcaagaggacgaggaggagtgtccctaacagtcgtgacattgacccttgggccgcctctaggactcattacaaactgtcagccttcggccagcacttttttctcaatctgactgccaattctggatttatggcaccggtttttaccgttagcctgcatgggaaacccaggggcaaccaaagcagctactacacggacaacactgactttcagcactgctttttcaatgggcatgtgaatcacagggcagagcatacggcagtcatcagcctttgttcagggatgctaggcacattcaagtctcaggacggggactatttcgtagaaccgttactctccgacgacagtgaatatgaagaagaacacaacaagccacacgtcgtctacagacacaacccacctcacagaaacatctcaagggaagagcagacgtgccacaccgcagagccaacgcacgcgtcagactcacacgcaaagggaggcgcccgactggaacaaaatgacccccattcagatgaccaggccttgaataagggcttgttaggaacccagaaccccctattcaataaagcagataacgccactgggacccggaccttgcgaaggaaaaagcgcttcctgtcttaccctcggtacgtggaagtgatggtggtggctgacaacaagatggttgaatatcacggcgctaatctgcagcattacgttctgactctcatgtccatagtagcttctatttataaggatccgagcattgggaatttaattaatattgccatagtgaagttagcagtggtccatgatgaacaggagggcccggccatctcattcaatgcccaaagcactttgaaaaacttttgcatatggcagcaatcgcagaacaacccggacgacaatcatccgtcgcaccacgataccgccgtgctcatcactcgacaggatatttgtaaggcgcaagaaaaatgcgacactttgggcctggccgaactgggcaccgtgtgtgacccctaccggagctgctccatcagtgaagacaacgggctcagcacggcatttactatagcacatgagcttggacacgtattcaacatgccgcacgacgacagcaacaaatgcaaagaggaaagcggcaaaaaccagcagcacgtcatggcgccgacccttaacttctacaccaacccctggatgtggtcaaagtgcagccggaaatacgtcacgcagtttctagacacgggttacggggagtgcctgctggatgagccaatctctagaacatacacactgcctcagcagctaccgggggctttgtacaatgtcaataagcaatgtgaattgatatttggaccgggatcccaggtgtgcccgtatatgcaaatgcagtgccggcgactgtggtgcatcagcagcgatgggcaacacaagggctgccggacccaacacacgccgtgggcagatggcaccgaatgtgagccggggaagcactgcagatacggagtatgtattcctaaagaacgggacgtacagattgcagatggatcttgggggtcctggagtccattcggagcctgctctcggtcatgtggtggtgggataaaaacttccatccgtgaatgcaatagacccgaaccaaaaaatggtggtaaatactgtgttgggcgtagaatgaagtttaaatcctgcaatacggagctgtgcgccaaacacaagagagacttcagagaggagcagtgcgcggatttcgacgggaagcattttaatattaatggtctacctccaaatgtgcgctgggtgcccaaatacagcggcattttaatgaaagaccgctgcaagctcttctgccgagtagcggggagcacggcttattatcagctcagggacagagtggtggatgggacgtcgtgtgggccggacactaacgatatctgcgtgcaaggactgtgtcggcaagctggatgcgaccatgtcctaaactcaaaggccagaagggacaagtgcggtgtttgtgggggagacaattcatcctgtaaaacaattgctggaacatataatatagtgcattacggctacaactccgtggttcgcattccagctggtgctactaaccttgacgttcgacaacacagctactcagggaagccagaagatgacaattaccttgctttgtcgaacagtcatggagaatttcttttaaatggagactttgtggtcagtatgttcaaaagggaaatcaaagtgggaaatgcggtgattgaatatagcgggtcggacaatgccatcgaaaggattaactgcacggatcgcattgagcaggaaatcgttctccagatcctgtcagttggtaatttatataatccagacgtgcggtatacttttaatattccaattgaagataaacctcagcagttttactggaatccatacgggccttggcagccctgcaacaaaatgtgccaaggggaacgaaagcagaaaccagtatgtatccgggattctgaccagctagttgtttcggatcagagatgtgatcggatccctcagccagagccagtaacagagccatgtaacactgaatgtgaagtggcacgtggccaggaagagtgaatgtacagtgcagtgcggcctgggataccggacactcgatattcactgcgccaaatacaccagggccgacggcaagaatgaaaaagtggacgagaggtattgcagccacctacagaaaccgctcactaaagagaagtgttccggagactgcaacacaggaggctggcgttattctccctggtcagaatgctccaaaagctgcgggacagggacgagaagacgcagggccatctgtgtgaacgcgttgcacgatattctggatgacagtaaatgtgggcagcaggagaagcctacggagcagcgctgcagcgagttcccctgcccccaatggaaaaccggcgactggtccgactgcctggtgacgtgtgggaaggggcacaaacatcgccagacctggtgtcagttcggagacgaccggttacacgacaggttctgcgacaccgagacaaagccggaatcggtcgaggcctgtgagcagccggaatgtgcctcctggcaggttggaccgtgggggcagtgtacggcagcctgtggcccaggataccagatgcgagtagtgaaatgcgtggtgggcgcttacagagcggtcgttgacgacagcgagtgcaatgctgcaacccgaccaacggacactcaggattgtgaagcggatgcgtgccccggcattcccgagaccaagcagatcgtgcacagcaggacccagtggcgcttcggatcttggaccccttgctcagcgacttgtgggaaaggaaccagaatgcgatacgtcagctgccgggatgatcaagggtctgtggcggacgaagcggcctgcgctcaactaccaaagccgctagcgaccgaagcgtgctctgtgaccccttgtggccaatggaaggccctagagtggagttcttgttctgtgacttgtggccaagggaaggcgacgcgccaagtcatttgcgtggatttcgctgatcagacagttgacgggagtgaatgtgacccagacgatgtaccagcagtggaacaggaatgctccatgtccccatgttattacctgaaccacgactacagcaaacccattcagaccgtcccaaacacagatcatcggatacgatctaatcccactctggccattctaaaccgaaacactggccgaccagccgggtcagggggcagccagtggcgaacaggcccttggggagcatgctccagtacctgcgccggaggattccagagacgggtcgttgtgtgtcaggatgaaaatggatatccagcaagtaactgtgatgagaaaaccaaacccattgagcagcggtcctgcgaatcgggatcgtgccctcagtgggcatttggaaactggggagagtgttccaaaaaatgtggcggtggaacgaggacacgacaggtggtttgtcagaggtccaacggggacatatttaatgatcttagctgtgaaattcttgataaaccgccggatcgtgagcagtgcaacatgcacagttgccctcgggagaccgggtggaacagtggcccctggaacgtgtgctctgtttcctgtggtcgtggcgtgaagacgagacccgtgtactgcgtgactaaagaaggagtgaccgtagagccggagaactgcaagcacttggccaagcccaacatacagaaaaagtgccgaggtgggaagtgcccgaaatggaaagctggagaatgggaaaagtgctcagtaacatgcgggagaggaatccagcaacgtgccgttcactgccaagtgggtgcccagaagatgagccgggagtcggagtgcccccagcgtgccaggcccccgtcggagcagtactgccaggtcgccgagtgtccgctttacacttggaaagctgaggaatggcaagaatgcagcaagacttgcgatgaaggcctccgctacaggaaagccatttgcctggatgaagacaagaaggaggttccccagtcccactgcgaggagaacaagaagccgccggaggtggagaaatgcaacgtgcagtcctgcgagttcctgtggatcacgggagagtggtcggagtgttcggtgacgtgcggcacgggttacaaacagagactggtgacctgcagtgaggtctattcggccaaagaccactatgaatacggctaccaaagctccgcaaactgcccgggggaacagccgcccaccgtccagaactgctaccaaggggagtgtccaatatccgcctcatggagagtcggcaactggggcaaatgctccgtcacctgcggatctggggtcacgcaacgttccgtgcagtgtctgaccaatgaggatctgccgagcaacatgtgcagcgtggatcagaagccggaagagaagaggatctgctacagcaaccacgactgtgacctgccgaggaattgtctagaagtgaagaggctgaaacacgtcggtgcggacggggaacactatgttatgatccaagaaaaaattataaagatatactgcgccgggatgcagtcggagagcccaaaggaatatatcactctactcagcggcgaggcggaaaattattcggaagtctatggttacaggttacagaaccccacggaatgcccgtataacggaagcagaagggaagactgtcagtgtaagaaggactacaccgccgccggcttctccaccttcagtaaagtgaggctggatgtggtgacgctgcagataattaccaccgatttgcactttgcacgaacgcaggatgggaggccggtaccgtttgccacagccggagactgttacagcgcagcaaagtgcccccagggtcgttttagcatcaaccttttaggaactggcctatcgatatcagaaacagcaaaatggatgtcacaagggaattatgcagtgacggaaataaaaaaatcaccggatggaaccaaagtgacgggaagatgtggcggttactgcgggaagtgtgtcccatcctcggcaactggtcttggcgttcacgtgttatagaactggtccataaacaagaagaagcaatgagacagatgaagagccgcgttgcaatacctctacgttcagcgtttgtacatgtgtaaatatcgctatgtaaaccaaatgatgtatattatatttatgtctgaaattatttattttgactaaatatttgtttgggttaaaaaagaaaaaaaaaaaaaaaaaa
Translation: MHFKRTRRSVPNSRDIDPWAASRTHYKLSAFGQHFFLNLTANSGFMAPVFTVSLHGKPRGNQSSYYTDNTDFQHCFFNGHVNHRAEHTAVISLCSGMLGTFKSQDGDYFVEPLLSDDSEYEEEHNKPHVVYRHNPPHRNISREEQTCHTAEPTHASDSHAKGGARLEQNDPHSDDQALNKGLLGTQNPLFNKADNATGTRTLRRKKRFLSYPRYVEVMVVADNKMVEYHGANLQHYVLTLMSIVASIYKDPSIGNLINIAIVKLAVVHDEQEGPAISFNAQSTLKNFCIWQQSQNNPDDNHPSHHDTAVLITRQDICKAQEKCDTLGLAELGTVCDPYRSCSISEDNGLSTAFTIAHELGHVFNMPHDDSNKCKEESGKNQQHVMAPTLNFYTNPWMWSKCSRKYVTQFLDTGYGECLLDEPISRTYTLPQQLPGALYNVNKQCELIFGPGSQVCPYMQMQCRRLWCISSDGQHKGCRTQHTPWADGTECEPGKHCRYGVCIPKERDVQIADGSWGSWSPFGACSRSCGGGIKTSIRECNRPEPKNGGKYCVGRRMKFKSCNTELCAKHKRDFREEQCADFDGKHFNINGLPPNVRWVPKYSGILMKDRCKLFCRVAGSTAYYQLRDRVVDGTSCGPDTNDICVQGLCRQAGCDHVLNSKARRDKCGVCGGDNSSCKTIAGTYNIVHYGYNSVVRIPAGATNLDVRQHSYSGKPEDDNYLALSNSHGEFLLNGDFVVSMFKREIKVGNAVIEYSGSDNAIERINCTDRIEQEIVLQILSVGNLYNPDVRYTFNIPIEDKPQQFYWNPYGPWQPCNKMCQGERKQKPVCIRDSDQLVVSDQRCDRIPQPEPVTEPCNTECEVARGQEE
Donor tissue: tailbud