ORFeome > adck1 – XORFeome 2.0

adck1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis aarF domain containing kinase 1, mRNA (cDNA clone MGC:97629 IMAGE:6979458), complete cds
Gene Symbol: adck1
Gene ID: 496824
ORF gb_acc: MG134443
ORF ID: 12144

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC088521

Library Location

Plate ID: GDExt11021
Well Location: F07

EST Sequences

Clone: MGC:97629 IMAGE:6979458
Trimmed Sequence: ATGGTGAGAGGCATTATCAGGGTTGTTTCCTTGGCTTCTGTAAGCCTTACTTCATCTGGGTTTTTCCTATATGGAACAGGGCACTGGGACCCAAGTGATTTTGGGGTAGTGCGAATTGGAAGAGCAGTTTTGACGACAGCAGCCATAACTTGGGATTATCTTACAGAACTAAGACATGTAAAGGCAGGTACAGAGGAGTATGAAAGCATCAAGTCACAGGTTCACTTTCGTTCAGCTCATCGCCTTCTGGATTTGTGTTGTGCCAACCGTGGGACCTTTATAAAAGTTGGACAGCACCTCGGAGCTTTGGAATATCTTGTGCCCCCTGAATACACCAAAACTTTAAGTGTTCTACATAGCCAGGCTCCCTGTACTCCTTTTCCTGATGTTGTGCAGGTCATTCGTGAGGATCTTGGCAAGGAGATATCTGAGGTCTTTGTGGAGTTTGAAGAAAAACCATTGGGTGCAGCCTCTCTGGCACAGGTGCACCGTGCTGTGCTGCAGGATGGGCGTAAAGTGGCTGTGAAGGTGCAGCATCCAAAAGTCCAGGCACAGAGTGCAAGGGATATTCTGCTCATGGAGGTCCTCCTACATGCTGTGAAGAAAATTTTTCCTCAGTTTGAATTTATGTGGCTTATTGAAGAAGCAAAAAAAAACCTACCTCTGGAGTTGGACTTCGAAAATGAGGGTCGCAATGCAGAGAAAATGTCAGCTATAGTCTCCAGTTTCTCTTTCCTGAGGATACCCAGAATCTACTGGGAACTTAGCACAAAACGTGTGCTTGTAATGGAGTACATGGAAGGAGGGCAGGTCAACGACAGGGAATATATGAAGCGTAATCAAATTGATATAAACCAGGTAGCTCGTGCTTTGGGGCAATTGTACAGTGAGATGATTTTTGTTCATGGATTTGTGCACTGTGATCCTCACCCAGGAAATGTTCTTGTACGTCAGAACCCTGAGACTCTTGTTCCAGAGATAATTCTTTTGGATCATGGCTTATACCAGGTACTGACAGAAAGTTTTCGTCTGGATTATTGCAGTTTATGGCAGGCTCTAATTGCTGCTGACATGCAGCAGATCCGCATATACAGCCAGCGCTTGGGTGCAGGAGAACTGTACCCTCTGTTTGCTTGTATGCTGACAGCCCGTTCCTGGGAATCTGTGAACCAAGGGATATATCAGAATACTGTTAGTAGGGAGGAGGCACTGGAGATACGAAGTAATGCTGCTACCTACCTACCAGAGATTAGCCAGCTTCTTGCTAGTGTCCCTCGTCAAATGTTGCTTCTTCTAAAAACCAATGACCTTCTACGTGGTATTGAGACATCTCTAGGAACTCATGCTAGCTCAAGCTCCTTCCTCAATATGTCCCGCTGTTGTGTACGAGCTCTTGCCAGACACAGAAAAGAGAAGACAGACTCTCTCTGGTCCTACATTCACATCTCTCTTGCAGAAACGTTTAGTCTCGGACAGCTTCAGATATATGAGATTGTTTTACGTCTTCAAGCCTCATGTGTGGGGTGCTGGATCCGTCGTATGATGCAATGGGTGTTCCTGTATATACACTGA
Full Trace Sequence: ctttttgagctatgaatgtgctagtggggaaatggtggcagaacttccccaacagcaacgtatttaaatatatcgcacgtcgcgaatgattttaaaccaagttccgctccgccttttaatgtttacatgtcgcaagaaacctctgtttgacgcctacccaaaactacaactaccgacattctttgcgtctgctgggcaaacccaaaatctgtacaaggggagagcttaggatcgagactaaagcggtgttaacgtaatggtgagaggcattatcagggttgtttccttggcttctgtaagccttacttcatctgggtttttcctatatggaacagggcactgggacccaagtgattttggggtagtgcgaattggaagagcagttttgacgacagcagccataacttgggattatcttacagaactaagacatgtaaaggcaggtacagaggagtatgaaagcatcaagtcacaggttcactttcgttcagctcatcgccttctggatttgtgttgtgccaaccgtgggacctttataaaagttggacagcacctcggagctttggaatatcttgtgccccctgaatacaccaaaactttaagtgttctacatagccaggctccctgtactccttttcctgatgttgtgcaggtcattcgtgaggatcttggcaaggagatatctgaggtctttgtggagtttgaagaaaaaccattgggtgcagcctctctggcacaggtgcaccgtgctgtgctgcaggatgggcgtaaagtggctgtgaaggtgcagcatccaaaagtccaggcacagagtgcaagggatattctgctcatggaggtcctcctacatgctgtgaagaaaatttttcctcagtttgaatttatgtggcttattgaagaagcaaaaaaaaacctacctctggagttggacttcgaaaatgagggtcgcaatgcagagaaaatgtcagctatagtctccagtttctctttcctgaggatacccagaatctactgggaacttagcacaaaacgtgtgcttgtaatggagtacatggaaggagggcaggtcaacgacagggaatatatgaagcgtaatcaaattgatataaaccaggtagctcgtgctttggggcaattgtacagtgagatgatttttgttcatggatttgtgcactgtgatcctcacccaggaaatgttcttgtacgtcagaaccctgagactcttgttccagagataattcttttggatcatggcttataccaggtactgacagaaagttttcgtctggattattgcagtttatggcaggctctaattgctgctgacatgcagcagatccgcatatacagccagcgcttgggtgcaggagaactgtaccctctgtttgcttgtatgctgacagcccgttcctgggaatctgtgaaccaagggatatatcagaatactgttagtagggaggaggcactggagatacgaagtaatgctgctacctacctaccagagattagccagcttcttgctagtgtccctcgtcaaatgttgcttcttctaaaaaccaatgaccttctacgtggtattgagacatctctaggaactcatgctagctcaagctccttcctcaatatgtcccgctgttgtgtacgagctcttgccagacacagaaaagagaagacagactctctctggtcctacattcacatctctcttgcagaaacgtttagtctcggacagcttcagatatatgagattgttttacgtcttcaagcctcatgtgtggggtgctggatccgtcgtatgatgcaatgggtgttcctgtatatacactgacccttcctgccccttcatttattattatattttttatcaataaaaaaacaacataaaaaaaaaaaaaaaaaaaaaaa
Translation: MVRGIIRVVSLASVSLTSSGFFLYGTGHWDPSDFGVVRIGRAVLTTAAITWDYLTELRHVKAGTEEYESIKSQVHFRSAHRLLDLCCANRGTFIKVGQHLGALEYLVPPEYTKTLSVLHSQAPCTPFPDVVQVIREDLGKEISEVFVEFEEKPLGAASLAQVHRAVLQDGRKVAVKVQHPKVQAQSARDILLMEVLLHAVKKIFPQFEFMWLIEEAKKNLPLELDFENEGRNAEKMSAIVSSFSFLRIPRIYWELSTKRVLVMEYMEGGQVNDREYMKRNQIDINQVARALGQLYSEMIFVHGFVHCDPHPGNVLVRQNPETLVPEIILLDHGLYQVLTESFRLDYCSLWQALIAADMQQIRIYSQRLGAGELYPLFACMLTARSWESVNQGIYQNTVSREEALEIRSNAATYLPEISQLLASVPRQMLLLLKTNDLLRGIETSLGTHASSSSFLNMSRCCVRALARHRKEKTDSLWSYIHISLAETFSLGQLQIYEIVLRLQASCVGCWIRRMMQWVFLYIH
Donor tissue: tailbud