ORFeome > adhfe1 – XORFeome 2.0

adhfe1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis alcohol dehydrogenase, iron containing, 1, mRNA (cDNA clone MGC:75621 IMAGE:5379357), complete cds
Gene Symbol: adhfe1
Gene ID: 394891
ORF gb_acc: MG132863
ORF ID: 10218

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064162

Library Location

Plate ID: GDExt11002
Well Location: F11

EST Sequences

Clone: MGC:75621 IMAGE:5379357
Trimmed Sequence: ATGGCTGCAAGACGGGACCAAGTGATCCATTTATTGAGGCAACTGCAGCGAGCATCATGCAAGTGTCCGGCTCATTCTCACACTTATTCTCAAGCTCCAGTTACTGGGAGAAAAACAGAGTATGCATTTGAGATGGCAGTTTCAAACATTAGATATGGAGAAAATGTTACCCAGGAAATTGGCATGGACTTGCAGAATCTGGGAGCCAGGAATGTGTGTGTGATGACTGATAGGAACCTTGTGGAGCTCTCCCCTGTGAAGGCTGTATTAAATTCACTAGTAAAGAATAACGTCAGCTTCAAATTGTATGACAGGGTCCGAGTGGAGCCAACCGATAAAAGCTTTATGGATGCTATTGAGTTTGCTAAGAAAGGGCAGTTTGATGCTTATGTTGGTGTTGGAGGAGGTTCTGTAATTGACACATGCAAAGCTGCCAACTTGTACTCTTCTAGCCCTGGGGCTGATTTCCTGGATTATGTCAACCCTCCAATAGGAAAAGGCAAAGCAGTGACCGTGCCACTTAAACCACTCATTGCGGTCCCAACCACATCTGGAACTGGAAGTGAGACAACAGGAATCGCTATATTCGACTATGAAGAACTAAAAGCTAAAACAGGTATTGCATCTAGAGCTATTAAGCCCACTCTAGGTTTGATTGACCCAGTGCACACACTTTCTATGCCTGAAAGAGTAGTTGCAAACAGCGGTTTTGATGTATTGTGCCATTCCCTGGAGTCCTACACTGCCCTTCCATATAACATGCGCAGCCCCTGTCCTACCAACCCAATTAACCGCCCAGCTTATCAGGGGAGCAACCCTATTAGCGATGTGTGGGCTAAACACGCCTTGAGGATCGTGGCCAAGTATTTAAAGAGAGCTGTAAGAAATCCTGATGACCGCGAAGCTCGGTTCGCCATGCACTTGGCAAGTTCATTTGCAGGAGTAGGCTTTGGAAATGCAGGGGTACACCTTTGCCACGGAATGTCGTACCCTATTGCAGGGCACGTGAAGACCTACAGAGCAAAAGATTACGAAGTGGATCATCCATTAGTGCCCCATGGCCTTTCTGTTGTTCTCACATCTCCTGCAGTATTTTCATTCACAGCATTAATGTGTCCTGAGCGACATCTGGAGGCAGCAGAAATACTGGGAGCTGACATCCGGACTGCCAAAATCAAAGAGGCCGGGCTTATCTTGGCAGACACCTTACGGAAATTTCTGTACGACCTGAATGTTGATGATGGTTTGGCAGCTGTAGGATATACTACTGAGGATATACCAGCCCTGGTGAAAGGAACTTTGCCCCAGGAACGAGTAACAAAGCTGTCTCCTCGAGCGCATTCAGAAGAGGAACTTGCCGGGTTATTTGAGGCCTCGATGAAACTCTATTGA
Full Trace Sequence: agaaagtactgcactcaggggccagccctccagaaggagccaagggagcactgaaactggcagtgtgtgcacagtgtataatcagttcccatacagaggcgttttagtgcgatggctgcaagacgggaccaagtgatccatttattgaggcaactgcagcgagcatcatgcaagtgtccggctcattctcacacttattctcaagctccagttactgggagaaaaacagagtatgcatttgagatggcagtttcaaacattagatatggagaaaatgttacccaggaaattggcatggacttgcagaatctgggagccaggaatgtgtgtgtgatgactgataggaaccttgtggagctctcccctgtgaaggctgtattaaattcactagtaaagaataacgtcagcttcaaattgtatgacagggtccgagtggagccaaccgataaaagctttatggatgctattgagtttgctaagaaagggcagtttgatgcttatgttggtgttggaggaggttctgtaattgacacatgcaaagctgccaacttgtactcttctagccctggggctgatttcctggattatgtcaaccctccaataggaaaaggcaaagcagtgaccgtgccacttaaaccactcattgcggtcccaaccacatctggaactggaagtgagacaacaggaatcgctatattcgactatgaagaactaaaagctaaaacaggtattgcatctagagctattaagcccactctaggtttgattgacccagtgcacacactttctatgcctgaaagagtagttgcaaacagcggttttgatgtattgtgccattccctggagtcctacactgcccttccatataacatgcgcagcccctgtcctaccaacccaattaaccgcccagcttatcaggggagcaaccctattagcgatgtgtgggctaaacacgccttgaggatcgtggccaagtatttaaagagagctgtaagaaatcctgatgaccgcgaagctcggttcgccatgcacttggcaagttcatttgcaggagtaggctttggaaatgcaggggtacacctttgccacggaatgtcgtaccctattgcagggcacgtgaagacctacagagcaaaagattacgaagtggatcatccattagtgccccatggcctttctgttgttctcacatctcctgcagtattttcattcacagcattaatgtgtcctgagcgacatctggaggcagcagaaatactgggagctgacatccggactgccaaaatcaaagaggccgggcttatcttggcagacaccttacggaaatttctgtacgacctgaatgttgatgatggtttggcagctgtaggatatactactgaggatataccagccctggtgaaaggaactttgccccaggaacgagtaacaaagctgtctcctcgagcgcattcagaagaggaacttgccgggttatttgaggcctcgatgaaactctattgatgcagattggtggttgatctgcataaatccatgagggaacatgcaagtgattggtattgttatctctaataaagctggggtcttgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAARRDQVIHLLRQLQRASCKCPAHSHTYSQAPVTGRKTEYAFEMAVSNIRYGENVTQEIGMDLQNLGARNVCVMTDRNLVELSPVKAVLNSLVKNNVSFKLYDRVRVEPTDKSFMDAIEFAKKGQFDAYVGVGGGSVIDTCKAANLYSSSPGADFLDYVNPPIGKGKAVTVPLKPLIAVPTTSGTGSETTGIAIFDYEELKAKTGIASRAIKPTLGLIDPVHTLSMPERVVANSGFDVLCHSLESYTALPYNMRSPCPTNPINRPAYQGSNPISDVWAKHALRIVAKYLKRAVRNPDDREARFAMHLASSFAGVGFGNAGVHLCHGMSYPIAGHVKTYRAKDYEVDHPLVPHGLSVVLTSPAVFSFTALMCPERHLEAAEILGADIRTAKIKEAGLILADTLRKFLYDLNVDDGLAAVGYTTEDIPALVKGTLPQERVTKLSPRAHSEEELAGLFEASMKLY
Donor tissue: tailbud