ORFeome > adss – XORFeome 2.0

adss – XORFeome 2.0

General Information

Species: Xenopus tropicalis adenylosuccinate synthase, mRNA (cDNA clone MGC:75901 IMAGE:5383487), complete cds
Gene Symbol: adss
Gene ID: 394644
ORF gb_acc: MG133023
ORF ID: 10412

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061354

Library Location

Plate ID: GDExt11004
Well Location: B11

EST Sequences

Clone: MGC:75901 IMAGE:5383487
Trimmed Sequence: ATGTCGGCAGAAAACGGATCGCCTGGGCTGCCAAACGGCGGAGTATGCTGCGCCACTGACAGTGGACGTTGCTCCCTCGTCGGGAACAAAGTCACAGTTGTGCTTGGGGCTCAGTGGGGAGACGAAGGGAAGGGTAAAGTTGTGGATCTTCTGGCTCAGGATGCGGATATCGTGTGCCGCTGCCAGGGAGGAAACAATGCAGGCCACACGGTTGTTGTGGATTCAGTTGAATATGATTTTCACCTTTTGCCAAGTGGAATCATTAATCAAAATGCTATTGCTTTCATAGGAAATGGTGTAGTAATTCATCTACCTGGCTTATTTGAAGAAGCAGAGAAAAATTTAAAGAAAGGGCAAGGTTTGGTTGGCTGGGAGAAGAGATTGTGTATCTCTGATAGAGCTCACATTGTGTTTGACTTCCATCAGGCTGCAGATGGCATCCAGGAGCAACAACGGCAAGAACAAGCTGGGAAAAATTTGGGCACAACAAAGAAGGGTATTGGACCAGTCTATTCTTCAAAAGCTGCTAGGAGTGGGCTCAGAATGTGTGATCTTGTTTCTGACTTCAGTGAATTCTCTCAGAGGTTTAAATTGTTGGCTAAGCAGTACAAGTCCATGTACCCATCCTTAGAAATAGACATTGATGGTGAATTAAAAAAGCTTCAGGATTATGCTGACAGAGTAAAACCGATGGTTAAAGATGGTGTTTATTATCTATATGAAGCCCTTCATGGTCCACCTAAGAACATTCTAGTAGAAGGTGCAAATGCTGCTCTTTTGGATATTGATTTTGGAACATATCCTTTTGTGACATCTTCAAACTGTACTGTTGGGGGAGTATGTACGGGCTTGGGAATTCCACCACAAAGTGTTGGCGATGTGTATGGTGTTGTGAAGGCATACACTACGAGGGTGGGAATCGGTGCCTTTCCAACAGAACAAAACAATGACACTGGAGAAATGCTGCAAACACGAGGCCATGAATATGGAGTTACCACTGGCAGAAAGAGGAGATGTGGATGGTTGGATCTAGTTTTGCTCCGATATGCTCACATGATAAATGGATTCACTGCGCTTGCTCTTACCAAACTTGATATCTTGGATGTCCTTTCTGAAATCAAAGTTGGTGTATCATACAAAATAGATGGCAAGAAGATACCTCATTTTCCAGCAAATCAAGAAGTTCTTAACAGAGTAGAGGTTGAATATGAGACACTTCCTGGGTGGAATACAGACACATGTAACGTTCGAACATTTGAAGAGCTGCCTGAAAATGCAAAGAAATATGTTCGATATATAGAATTAGAACTTGGAATTCCTATTAAATGGATTGGTGTTGGAAAATCCAGAGAGTCGATGATTCAGCTGTTCTAA
Full Trace Sequence: ggagtaggaagggaaagtggcattttgtatagaagcgtgtcaggtttgagagttctacaggaagtagtgttataggttgctctgtacttctcccagcctttcggccatatcctttgtaagcttaacccactgtcagtaatcatgtcggcagaaaacggatcgcctgggctgccaaacggcggagtatgctgcgccactgacagtggacgttgctccctcgtcgggaacaaagtcacagttgtgcttggggctcagtggggagacgaagggaagggtaaagttgtggatcttctggctcaggatgcggatatcgtgtgccgctgccagggaggaaacaatgcaggccacacggttgttgtggattcagttgaatatgattttcaccttttgccaagtggaatcattaatcaaaatgctattgctttcataggaaatggtgtagtaattcatctacctggcttatttgaagaagcagagaaaaatttaaagaaagggcaaggtttggttggctgggagaagagattgtgtatctctgatagagctcacattgtgtttgacttccatcaggctgcagatggcatccaggagcaacaacggcaagaacaagctgggaaaaatttgggcacaacaaagaagggtattggaccagtctattcttcaaaagctgctaggagtgggctcagaatgtgtgatcttgtttctgacttcagtgaattctctcagaggtttaaattgttggctaagcagtacaagtccatgtacccatccttagaaatagacattgatggtgaattaaaaaagcttcaggattatgctgacagagtaaaaccgatggttaaagatggtgtttattatctatatgaagcccttcatggtccacctaagaacattctagtagaaggtgcaaatgctgctcttttggatattgattttggaacatatccttttgtgacatcttcaaactgtactgttgggggagtatgtacgggcttgggaattccaccacaaagtgttggcgatgtgtatggtgttgtgaaggcatacactacgagggtgggaatcggtgcctttccaacagaacaaaacaatgacactggagaaatgctgcaaacacgaggccatgaatatggagttaccactggcagaaagaggagatgtggatggttggatctagttttgctccgatatgctcacatgataaatggattcactgcgcttgctcttaccaaacttgatatcttggatgtcctttctgaaatcaaagttggtgtatcatacaaaatagatggcaagaagatacctcattttccagcaaatcaagaagttcttaacagagtagaggttgaatatgagacacttcctgggtggaatacagacacatgtaacgttcgaacatttgaagagctgcctgaaaatgcaaagaaatatgttcgatatatagaattagaacttggaattcctattaaatggattggtgttggaaaatccagagagtcgatgattcagctgttctaagaagatgcacactgcacaggctgcctcctcaagatgacaccattctacagataaagcttctcacttgtacatagagaacaaatgcatgggcaacaaaatatcacttccagattcatcttttgttatgccctaatttatttagtctttttcacaatctagtaaaagaaagcagtcaaaattgtcctactgtttattttctatcgcattaggacatttgtggtctggttattaaactggcagtactttaaagactgagtgacttctttgttcagttttggaaaggaccatcacacattgaactggctattttttctgtataaaattaaaaaaaacaccctagtacctatatgtgcgcatctggtacaactttgttgacagtctgcaatttcaagttgtgagactgaatcagaattcttttacacatttttacatctttctattgatttcttaacataactcatgtaatgtatggggaggaaatatccatatttttaaagcaatcataattggtgtgaatgattttgttttaaaatgtattgcactgcaatacttgcactgtgcaaaacaaatgggtagacagtctatatttgtaaattattgaataagagtttaaggttccaacccaagaaaagcatggttgcataaaaattgttcaaatttaaaataaataaaacaaaagataaaaaaaaaaaaaaaaaaaa
Translation: MSAENGSPGLPNGGVCCATDSGRCSLVGNKVTVVLGAQWGDEGKGKVVDLLAQDADIVCRCQGGNNAGHTVVVDSVEYDFHLLPSGIINQNAIAFIGNGVVIHLPGLFEEAEKNLKKGQGLVGWEKRLCISDRAHIVFDFHQAADGIQEQQRQEQAGKNLGTTKKGIGPVYSSKAARSGLRMCDLVSDFSEFSQRFKLLAKQYKSMYPSLEIDIDGELKKLQDYADRVKPMVKDGVYYLYEALHGPPKNILVEGANAALLDIDFGTYPFVTSSNCTVGGVCTGLGIPPQSVGDVYGVVKAYTTRVGIGAFPTEQNNDTGEMLQTRGHEYGVTTGRKRRCGWLDLVLLRYAHMINGFTALALTKLDILDVLSEIKVGVSYKIDGKKIPHFPANQEVLNRVEVEYETLPGWNTDTCNVRTFEELPENAKKYVRYIELELGIPIKWIGVGKSRESMIQLF
Donor tissue: neurula