ORFeome > agxt – XORFeome 2.0

agxt – XORFeome 2.0

General Information

Species: Xenopus tropicalis alanine-glyoxylate aminotransferase (oxalosis I; hyperoxaluria I; glycolicaciduria; serine-pyruvate aminotransferase), mRNA (cDNA clone MGC:89171 IMAGE:7016326), complete cds
Gene Symbol: agxt
Gene ID: 448338
ORF gb_acc:
ORF ID: 11828

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075417

Library Location

Plate ID: GDExt11018
Well Location: F04

EST Sequences

Clone: MGC:89171 IMAGE:7016326
Trimmed Sequence: ATGTCTTCGCTTGCCACTATCCCTCCACCTTCAGCTCTTCTACAACCTCTGAATGTCCCCCAACGCCTCATGCTTGGACCAGGACCCTCCAATGTACCTCCTCGGATTCAAGCAGCAGGGGCTTTACAGCTTATTGGTCATATGCACCCTGAAATGTTCCAGATAATGGATGATATCAAGCAAGGGATACGGTATGCTTTCCAGACACAAAACAACCTGACATTAGCTGTGAGTGGATCTGGCCACTGTGCCATGGAGACTGCAATTTTTAACGTGGTGGAGAAAGGAGACGTGGTCCTAATTGCTGTAAAAGGAATTTGGGGGGAGAGAGCGGGTGACATTGCAGAGCGAATTGGTGCTGATGTACGATATGTGTCAAAACCAGTAGGAGAAGGCTTTACCCTTAAGGAAGTAGAAAAGGCTTTAGTGGAGCACAAGCCGTCCCTCTTCTTCATTACCCATGGAGAGTCATCCAGTGGAGTAGTTCAACCGTTAGATGGCCTGGGAGATCTCTGTCACCGGTATAACTGTCTACTGCTTGTAGATTCAGTAGCCTCTCTAGGTGGAGCTCCAATCTACATGGACAAACAGGGAATCGACATTTTGTATTCTGGATCTCAGAAGGTTCTGAATGCACCTCCAGGAACAGCTCCCATTTCTTTTAGTGAAACTGCAAGTAAGAAGATTTTCAGCCGTAAAACAAAACCTCCATCTCTCTATGTGGATTTAAAATGGCTTGCAAACTATTGGGGATGTGATGGCAAACCAAGAATATACCACCACACAGGACCAGTGACTAACTTCTTCAGCTTGAGAGAAGGACTGGCAGTTCTAGCTGAGCAGGGATTGGAACGCTCATGGGCTGTTCACCAGGAGAATGCACTGAAGCTGCATAAAGGATTGGAAGCATTAGGACTGAAGCTCTTTGTGAAGGACCCAGCACTGCGCCTCCCTACTGTCACAACAGTTAGCGTTCCTAATGGTTATGAATGGAGAGACATAACTACATTTATCATGAAGAATCATGCCATTGAAATCACAGGAGGCCTGGGACCATCTACTGGAAAGGTTCTGCGTATTGGCCTGATGGGCTATAACTCAACGCAAGCAAACGTAGACCGTGTTCTAGAGGCTCTGCGCGATGCCCTGCAGCACTGCCCTAAAAATAAGATGTAA
Full Trace Sequence: gtggacaaagcgcggcatgcattagacaagtgagctttaggaccagaatcaaaatagggactaggtgaaggttcactgggcgtcatctatttaagacctattagaagttaaacaagatgcaagggtcagttagaagcatttcttcttctcttctttgtgctgcacgcctctctgcttctgtcagaatcatgtcttcgcttgccactatccctccaccttcagctcttctacaacctctgaatgtcccccaacgcctcatgcttggaccaggaccctccaatgtacctcctcggattcaagcagcaggggctttacagcttattggtcatatgcaccctgaaatgttccagataatggatgatatcaagcaagggatacggtatgctttccagacacaaaacaacctgacattagctgtgagtggatctggccactgtgccatggagactgcaatttttaacgtggtggagaaaggagacgtggtcctaattgctgtaaaaggaatttggggggagagagcgggtgacattgcagagcgaattggtgctgatgtacgatatgtgtcaaaaccagtaggagaaggctttacccttaaggaagtagaaaaggctttagtggagcacaagccgtccctcttcttcattacccatggagagtcatccagtggagtagttcaaccgttagatggcctgggagatctctgtcaccggtataactgtctactgcttgtagattcagtagcctctctaggtggagctccaatctacatggacaaacagggaatcgacattttgtattctggatctcagaaggttctgaatgcacctccaggaacagctcccatttcttttagtgaaactgcaagtaagaagattttcagccgtaaaacaaaacctccatctctctatgtggatttaaaatggcttgcaaactattggggatgtgatggcaaaccaagaatataccaccacacaggaccagtgactaacttcttcagcttgagagaaggactggcagttctagctgagcagggattggaacgctcatgggctgttcaccaggagaatgcactgaagctgcataaaggattggaagcattaggactgaagctctttgtgaaggacccagcactgcgcctccctactgtcacaacagttagcgttcctaatggttatgaatggagagacataactacatttatcatgaagaatcatgccattgaaatcacaggaggcctgggaccatctactggaaaggttctgcgtattggcctgatgggctataactcaacgcaagcaaacgtagaccgtgttctagaggctctgcgcgatgccctgcagcactgccctaaaaataagatgtaaataacctttgttgaaggctcctaaaattgtcaataaaagcacactgttacttccctctggacaatatatattaatcatcttctttctaccactgtcacagatacctcaatgaaatattaaaataactgattatttgttaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSSLATIPPPSALLQPLNVPQRLMLGPGPSNVPPRIQAAGALQLIGHMHPEMFQIMDDIKQGIRYAFQTQNNLTLAVSGSGHCAMETAIFNVVEKGDVVLIAVKGIWGERAGDIAERIGADVRYVSKPVGEGFTLKEVEKALVEHKPSLFFITHGESSSGVVQPLDGLGDLCHRYNCLLLVDSVASLGGAPIYMDKQGIDILYSGSQKVLNAPPGTAPISFSETASKKIFSRKTKPPSLYVDLKWLANYWGCDGKPRIYHHTGPVTNFFSLREGLAVLAEQGLERSWAVHQENALKLHKGLEALGLKLFVKDPALRLPTVTTVSVPNGYEWRDITTFIMKNHAIEITGGLGPSTGKVLRIGLMGYNSTQANVDRVLEALRDALQHCPKNKM
Donor tissue: