ORFeome > aldh1a1 – XORFeome 2.0

aldh1a1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis aldehyde dehydrogenase 1 family, member A1, mRNA (cDNA clone MGC:107771 IMAGE:7007049), complete cds
Gene Symbol: aldh1a1
Gene ID: 613078
ORF gb_acc: MG134689
ORF ID: 12422

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC096010

Library Location

Plate ID: GDExt11024
Well Location: B07

EST Sequences

Clone: MGC:107771 IMAGE:7007049
Trimmed Sequence: ATGTCCGAGAAAACCCTTCCTCAAGATTTGCCAGCTCCAATAAGCAACTTGGAGATAAAATACAGAAAGATTTTTATAAACAATGAATGGCACAATTCTGTAAGTGGGAAAAAGTTCCCTGTCTACAATCCAGCTACAGGAGAGAAAATATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAGAGAAGCTTTCCAGATAGGGTCCCCATGGCGAAGGCTGGATGCTTCTGAAAGGGGGAGGATCCTTAATAAGTTGGCTGACCTTGTGGAACGTGATAGGTCAATACTAAGTACCATGGAATCTATTGATGGTGGAAAGCCATTTGCTGCATCCTATTATGGAGATATACCTGGAGCTATTAAATCACTGCGCTACTGTGCAGGATGGGCTGACAAAAACCAAGGCCGTACAATACCAATGGATGGTGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTATGTGGACAAATAATCCCATGGAACTTTCCGTTGGTGATGTTTGCTTGGAAAATTGCTCCTGCTTTATGCTGTGGTAACACAGTTGTCATCAAACCAGCTGAACAAACACCACTGACTGCTCTATACATGGGATCATTAATAAAAGAGGCAGGAATTCCTCCTGGGGTAGTGAATATTGTACCAGGATATGGACCAACAGCAGGAGCAGCTATAGCCTATCATATGGAAATAGACAAAGTAGCTTTCACTGGTTCAACAGAGGTTGGAAAACTGATAAAAGAAGCAGCAGGAAAGAGCAACCTTAAAAGAGTCACTCTTGAACTTGGTGGAAAAAGCCCCAACATCATTTTTGCAGATGCAGACTTGGATTTGGCAGTTGAACATGCACACAATGGCCTGTTCTTCCATCAGGGCCAGTGCTGCATAGCAGGATCCAGGATATTTGTGGAAGAACCAATCTATGATGAATTTGTGCGTAAGAGTGTTGAAAGGGCCAAAAAACGTGTTCTTGGAGATCCTCTTTCTCCTTGTGTAAACCAAGGACCACAGATTGACAAGGATCAATTCGACAAAATTCTTGAATTGATTGAGAGTGGTAAGAAAGAAGGAGCAAAGTTGGAATGCGGGGGAAGTGCATGGGGTGAGAAAGGTTTCTATATAAGCCCCACGGTCTTTTCAGATGTGAAGGATGATATGCGTATAGCCAAAGAAGAAATTTTTGGGCCTGTGCAACAAATCCTGAAGTTTAAGAGAATTGATGAAGTTATTAAAAGGGCTAACAATACAAACTATGGATTAGCTGCAGGAGTTTTCACCAAAGACATGGACAAAGCAATATTAATGTCTACGGCTCTTCAGGCTGGAACTGTGTGGATAAATTGCTACAGTGCAATGTCGCCACAAAGCCCTTTTGGCGGGTTTAAGATGTCCGGAAATGGCCGTGAAATGGGAGAATATGGTCTGCATGAATACACTGAAGTCAAGACAGTCATCATGAAAATTTCACAGAAGAATTCCTAA
Full Trace Sequence: gtctgagtaaagaggcttcaaacatgtccgagaaaacccttcctcaagatttgccagctccaataagcaacttggagataaaatacagaaagatttttataaacaatgaatggcacaattctgtaagtgggaaaaagttccctgtctacaatccagctacaggagagaaaatatgtgaggtggaagaaggagataaggaagatgtgaacaaggctgtgaaagcagcaagagaagctttccagatagggtccccatggcgaaggctggatgcttctgaaagggggaggatccttaataagttggctgaccttgtggaacgtgataggtcaatactaagtaccatggaatctattgatggtggaaagccatttgctgcatcctattatggagatatacctggagctattaaatcactgcgctactgtgcaggatgggctgacaaaaaccaaggccgtacaataccaatggatggtgactattttacttttacaagacatgagcctgttggagtatgtggacaaataatcccatggaactttccgttggtgatgtttgcttggaaaattgctcctgctttatgctgtggtaacacagttgtcatcaaaccagctgaacaaacaccactgactgctctatacatgggatcattaataaaagaggcaggaattcctcctggggtagtgaatattgtaccaggatatggaccaacagcaggagcagctatagcctatcatatggaaatagacaaagtagctttcactggttcaacagaggttggaaaactgataaaagaagcagcaggaaagagcaaccttaaaagagtcactcttgaacttggtggaaaaagccccaacatcatttttgcagatgcagacttggatttggcagttgaacatgcacacaatggcctgttcttccatcagggccagtgctgcatagcaggatccaggatatttgtggaagaaccaatctatgatgaatttgtgcgtaagagtgttgaaagggccaaaaaacgtgttcttggagatcctctttctccttgtgtaaaccaaggaccacagattgacaaggatcaattcgacaaaattcttgaattgattgagagtggtaagaaagaaggagcaaagttggaatgcgggggaagtgcatggggtgagaaaggtttctatataagccccacggtcttttcagatgtgaaggatgatatgcgtatagccaaagaagaaatttttgggcctgtgcaacaaatcctgaagtttaagagaattgatgaagttattaaaagggctaacaatacaaactatggattagctgcaggagttttcaccaaagacatggacaaagcaatattaatgtctacggctcttcaggctggaactgtgtggataaattgctacagtgcaatgtcgccacaaagcccttttggcgggtttaagatgtccggaaatggccgtgaaatgggagaatatggtctgcatgaatacactgaagtcaagacagtcatcatgaaaatttcacagaagaattcctaaaaatgtcacagcactgatatcccgaatgcctggaggatcgtggaaatactgccatatttttgtgtgtttaaatctgattctaacaacagctgcaaacatttgtggtgctgttgaaagatctcctttattattatagtgaagttgaccatggtatcacttgtcaatatgtttggaaaacaatagacttttgtgttactgatcctgcagtgcatgacctcattgtcactgttatagacaatatacccagcatatcatgctgtccctgtcacagttctgtgttttatgatctggtgcagaaatcattcaatgattttagtctcgtttaacccttgaatttaaagttttgctaggaaaaggaagtaggataaaatcatatgtaaagtatactggaatatattagaagtgtttagttgcaaagttaaatatacaagaagggaaaaaacacagcaaagtgctgccatatatatatatatatatataaagcaaatatattaagaaaaggaatgtaagttgatgctaaatctggaatcaccaagtgcactactttaagtcttttaaaaatgctttataaaggtgaccatacatggtaagagccgctcgttggcaaggccctgaggccaaccaatcgaattagaacagcgggtataggtgctgttggttcggggaccccagttcgatggaaaactcaaacctgcccgatcgagatctgcctgatttcaggccgaatgttggtcgggcaggcctgccgttcatgcccatacaaaggcagataagctgctgaatcagtcttaaggactgacatcagcagctagaatcagcccgtgtatggccacctttaagcatctagttatacagagatggtgttacactggaacagcttagttttaccagctggtatataaaatgattcagaaaaaaacaattcctttttattgtggtaggtgctaaaacaaactgctgtataaaagtagagctttacaaaaatgcattacatatcgatttttacctccccttggaactcaagacaatgtgaatttaatttttcattcaaatgcgcctttgtgcttggcagttgtttcaaaaacaaaaccggcaattcatggatcgtctcatgagtgtaataaataagctttttttctttcagaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSEKTLPQDLPAPISNLEIKYRKIFINNEWHNSVSGKKFPVYNPATGEKICEVEEGDKEDVNKAVKAAREAFQIGSPWRRLDASERGRILNKLADLVERDRSILSTMESIDGGKPFAASYYGDIPGAIKSLRYCAGWADKNQGRTIPMDGDYFTFTRHEPVGVCGQIIPWNFPLVMFAWKIAPALCCGNTVVIKPAEQTPLTALYMGSLIKEAGIPPGVVNIVPGYGPTAGAAIAYHMEIDKVAFTGSTEVGKLIKEAAGKSNLKRVTLELGGKSPNIIFADADLDLAVEHAHNGLFFHQGQCCIAGSRIFVEEPIYDEFVRKSVERAKKRVLGDPLSPCVNQGPQIDKDQFDKILELIESGKKEGAKLECGGSAWGEKGFYISPTVFSDVKDDMRIAKEEIFGPVQQILKFKRIDEVIKRANNTNYGLAAGVFTKDMDKAILMSTALQAGTVWINCYSAMSPQSPFGGFKMSGNGREMGEYGLHEYTEVKTVIMKISQKNS
Donor tissue: