ORFeome > alg11 – XORFeome 2.0

alg11 – XORFeome 2.0

General Information

Species: Xenopus tropicalis asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog, mRNA (cDNA clone MGC:76133 IMAGE:5309356), complete cds
Gene Symbol: alg11
Gene ID: 394898
ORF gb_acc: MG132699
ORF ID: 9990

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064222

Library Location

Plate ID: GDExt11001
Well Location: G05

EST Sequences

Clone: MGC:76133 IMAGE:5309356
Trimmed Sequence: ATGGCAGGGATTCTGTGCTTATGTGGGATGATGCGACTGTTGACTGCCTTGTTCATCCCAGTACTGATTGCCAGCATTGGTTTGTGCCTCGTCTTGGTGTTGCTCTTTATTTGCACTCGATTGTGGATTCAGCGAAAGAAAAAGCAGAGCGTGGAAATAGGAAAAGATGGGAAAAAGAAAAGAGTGGTGGCGTTTTTTCACCCATACTGCAATGCTGGAGGTGGAGGAGAGAGAGTACTGTGGTGTGCACTGAGATCTCTGCAAAAGAGGTACAAAGATGCGATCTATGTCATTTATACCGGTGACAAAGATGTGTCTGAGGAACAGATCCTTAATGGCGCAGCTGCAAGGTTTAACATCAAGCTGTCCCACCCTGTAAAGTTCATCTTCCTGGAAAAGCGAGGACTTGTGGAAGCGAGTTTTTATCCCCGTTTTACTTTGCTGGGCCAGAGTCTGGGCTCTGTTGTTTTAGGCTGGGAAGCTCTTACAAAGTGTGTGCCAGATATTTACATTGATTCTATGGGCTATGCATTTACATTGCCTCTTTTCAAGTATGTCGGAGGATGCCAAGTTGGCTGCTATGTGCATTACCCTACTATCAGCATGGATATGCTGTCTGTTGTGCGCAGCCAGAACGCGAGATTCAACAATGCTGCTTTCATCTCTAACAATCCTGTTCTGAGCAGGCTCAAACTGATTTATTATTACCTGTTTGCAGTAATCTATGGATGGGTTGGTTCATGTAGTGACGTCATCATGGTTAACTCAACATGGACTTTCGCCCACATCCTTGATCTTTGGAAGTGTAGTGAGCGTACCAGCATCGTTTATCCCCCTTGTGATGTTCAGACATTTTTAGATATTAATTTGAATCAGCACAAAGACATAGAGGAGCATTCCATTGTTTCTATTGGGCAGTTTAGGCCCGAGAAGGACCACCCTTTGCAAATATGCGCGTTTGCAGCCTTACTTAAAAAGAAAACCACTGAAAAACTTAAGCTGAAACTTATCCTAATTGGGGGATGTCGAAACAATGAAGATGAACTACGTGTATCAGAACTGAAAAAACTCAGCTCTGAACTCGGAATTCCTGTGGAGTTCAAAGTAAACATTCCGTTTGCAGAACTAAAGAAACATTTGAGTGAAGCTACCATTGGCTTGCACACCATGTGGAACGAGCACTTTGGAATTGGCATAGTTGAGTGCATGGCAGCTGGTACCATAATTCTGGCTCATAACTCTGGAGGCCCAAAACTGGATATTGTGGTGCCTTATGAAGAACATGAGACTGGCTTCTTGGCAGATAGCGTGGAGAGCTATGCAGCAGCAATGGATTATATTCTGTGTCTGACACCAGAACAGAGGCTAACTATAAGGCAAAATGCACGTCGTTCTGTTGCCAGATTTTCAGATCAGGAATTTGAAGCTAATTTCCTAGCCTCTTCAGAGCCACTATTTATGTGA
Full Trace Sequence: gtcatggcagggattctgtgcttatgtgggatgatgcgactgttgactgccttgttcatcccagtactgattgccagcattggtttgtgcctcgtcttggtgttgctctttatttgcactcgattgtggattcagcgaaagaaaaagcagagcgtggaaataggaaaagatgggaaaaagaaaagagtggtggcgttttttcacccatactgcaatgctggaggtggaggagagagagtactgtggtgtgcactgagatctctgcaaaagaggtacaaagatgcgatctatgtcatttataccggtgacaaagatgtgtctgaggaacagatccttaatggcgcagctgcaaggtttaacatcaagctgtcccaccctgtaaagttcatcttcctggaaaagcgaggacttgtggaagcgagtttttatccccgttttactttgctgggccagagtctgggctctgttgttttaggctgggaagctcttacaaagtgtgtgccagatatttacattgattctatgggctatgcatttacattgcctcttttcaagtatgtcggaggatgccaagttggctgctatgtgcattaccctactatcagcatggatatgctgtctgttgtgcgcagccagaacgcgagattcaacaatgctgctttcatctctaacaatcctgttctgagcaggctcaaactgatttattattacctgtttgcagtaatctatggatgggttggttcatgtagtgacgtcatcatggttaactcaacatggactttcgcccacatccttgatctttggaagtgtagtgagcgtaccagcatcgtttatcccccttgtgatgttcagacatttttagatattaatttgaatcagcacaaagacatagaggagcattccattgtttctattgggcagtttaggcccgagaaggaccaccctttgcaaatatgcgcgtttgcagccttacttaaaaagaaaaccactgaaaaacttaagctgaaacttatcctaattgggggatgtcgaaacaatgaagatgaactacgtgtatcagaactgaaaaaactcagctctgaactcggaattcctgtggagttcaaagtaaacattccgtttgcagaactaaagaaacatttgagtgaagctaccattggcttgcacaccatgtggaacgagcactttggaattggcatagttgagtgcatggcagctggtaccataattctggctcataactctggaggcccaaaactggatattgtggtgccttatgaagaacatgagactggcttcttggcagatagcgtggagagctatgcagcagcaatggattatattctgtgtctgacaccagaacagaggctaactataaggcaaaatgcacgtcgttctgttgccagattttcagatcaggaatttgaagctaatttcctagcctcttcagagccactatttatgtgagccatttgacaatgttccctgtatatattttattttccgcgctgaggacagcagctgtataaaatgttttttttattgtgcactgtaaatatacagtgatattcgcagataataatatacactgagtacttggagctacaaactctgtaagaccttgctaaagtcgtggcaggtaaagttaatttatttatgagctggtgggatctaatttattagtaatataaagccactgtgattatatggaattgtgcaggttacttattgctaactaactttgctactgcattaaactttggggtttaaaagaactcagtcgtgacaactatctgcccatagagtacaattgcgtcaccgcgacaaatcgcatgcacagttttgttgcgtagattagtcgctgcgacttttcaaaaaagttgcagtgactaatctacacgtgtgtcttcgctctaaggcagtggttgtcagcctttgtcaatgcaagccccacttaaaggtaaactctggttactgaaacaaaatttgttaaaaagccccgtacaacacaaaaacccctaatatacctatccctgtaatctgttgcttcaaaacgtatgaataaataccatttttataaaatgaaaaaaaaaaaaaaaaaaa
Translation: MAGILCLCGMMRLLTALFIPVLIASIGLCLVLVLLFICTRLWIQRKKKQSVEIGKDGKKKRVVAFFHPYCNAGGGGERVLWCALRSLQKRYKDAIYVIYTGDKDVSEEQILNGAAARFNIKLSHPVKFIFLEKRGLVEASFYPRFTLLGQSLGSVVLGWEALTKCVPDIYIDSMGYAFTLPLFKYVGGCQVGCYVHYPTISMDMLSVVRSQNARFNNAAFISNNPVLSRLKLIYYYLFAVIYGWVGSCSDVIMVNSTWTFAHILDLWKCSERTSIVYPPCDVQTFLDINLNQHKDIEEHSIVSIGQFRPEKDHPLQICAFAALLKKKTTEKLKLKLILIGGCRNNEDELRVSELKKLSSELGIPVEFKVNIPFAELKKHLSEATIGLHTMWNEHFGIGIVECMAAGTIILAHNSGGPKLDIVVPYEEHETGFLADSVESYAAAMDYILCLTPEQRLTIRQNARRSVARFSDQEFEANFLASSEPLFM
Donor tissue: gastrula