ORFeome > ap2m1 – XORFeome 2.0

ap2m1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis adaptor protein complex AP-2, mu1, mRNA (cDNA clone MGC:75936 IMAGE:5383841), complete cds
Gene Symbol: ap2m1
Gene ID: 394572
ORF gb_acc: MG133014
ORF ID: 10402

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061374

Library Location

Plate ID: GDExt11004
Well Location: C12

EST Sequences

Clone: MGC:75936 IMAGE:5383841
Trimmed Sequence: ATGATTGGGGGACTGTTCATATATAATCATAAGGGCGAGGTCCTTATCTCCCGGGTGTACAGAGATGACATTGGGCGGAATGCTGTGGATGCTTTCCGTGTTAATGTCATCCATGCCCGGCAGCAGGTGCGCTCGCCAGTCACTAACATTGCCCGCACAAGCTTCTTTCACGTAAAACGGTCAAACATCTGGCTAGCTGCAGTCACCAAACAAAATGTTAATGCTGCCATGGTGTTTGAGTTTCTCTACAAAATGTGTGACGTGATGACTGCATACTTTGGAAAGATCAGCGAGGAGAACATAAAGAACAACTTTGTGCTGATCTACGAGCTGCTAGATGAAATCCTGGATTTTGGTTACCCTCAGAATTCTGAAACAGGAGCACTGAAGACTTTCATCACCCAACAAGGGATTAAAAGTCAGCATCAGACCAAGGAGGAGCAGTCTCAGATTACTAGCCAGGTTACTGGCCAAATTGGGTGGAGACGTGAAGGCATTAAGTATCGTCGAAATGAGCTGTTCTTAGATGTGTTAGAGAGTGTCAACCTGCTAATGTCACCTCAAGGGCAGGTACTTAGCGCTCATGTGTCTGGGCGTGTGGTGATGAAGAGCTACCTGAGTGGAATGCCAGAGTGCAAGTTTGGAATGAATGACAAAATAGTGATTGAGAAACAAGGCAAAGGAACCGCTGATGAGACTGGCAAAACGGGAAAGCAATCAATTGCCATTGATGACTGTACATTCCACCAGTGTGTCCGGCTTAGCAAATTTGACTCTGAGCGCAGCATCAGCTTTATACCTCCAGATGGAGAATTTGAGCTTATGAGATATCGAACCACAAAAGACATCATCCTACCATTCCGTGTCATTCCTCTTGTTCGTGAAGTGGGGCGCACAAAGCTTGAGGTCAAGGTGGTCATCAAATCTAATTTTAAACCTTCACTTTTGGCTCAGAAGATTGAGGTGAGGATTCCAACCCCACTCAACACCAGTGGAGTACAGGTCATCTGTATGAAAGGAAAAGCAAAGTATAAGGCCAGTGAGAATGCCATTGTGTGGAAAATAAAGCGCATGGCTGGTATGAAGGAATCTCAGATAAGTGCAGAGATTGAGCTGCTTCCTACTAATGATAAGAAGAAATGGGCTCGGCCTCCAATATCCATGAACTTTGAGGTCCCGTTTGCCCCATCTGGGCTCAAAGTGCGTTACCTGAAGGTGTTTGAACCAAAACTAAACTACAGCGACCATGATGTGATCAAATGGGTGCGATACATTGGCCGCAGTGGGATCTATGAGACACGGTGTTAA
Full Trace Sequence: cttgggctctgtgctgaggagccgcgagagagtgaagatctatgtttctaagcatcatgggaagagaaaactaagaagaattcaccatgattgggggactgttcatatataatcataagggcgaggtccttatctcccgggtgtacagagatgacattgggcggaatgctgtggatgctttccgtgttaatgtcatccatgcccggcagcaggtgcgctcgccagtcactaacattgcccgcacaagcttctttcacgtaaaacggtcaaacatctggctagctgcagtcaccaaacaaaatgttaatgctgccatggtgtttgagtttctctacaaaatgtgtgacgtgatgactgcatactttggaaagatcagcgaggagaacataaagaacaactttgtgctgatctacgagctgctagatgaaatcctggattttggttaccctcagaattctgaaacaggagcactgaagactttcatcacccaacaagggattaaaagtcagcatcagaccaaggaggagcagtctcagattactagccaggttactggccaaattgggtggagacgtgaaggcattaagtatcgtcgaaatgagctgttcttagatgtgttagagagtgtcaacctgctaatgtcacctcaagggcaggtacttagcgctcatgtgtctgggcgtgtggtgatgaagagctacctgagtggaatgccagagtgcaagtttggaatgaatgacaaaatagtgattgagaaacaaggcaaaggaaccgctgatgagactggcaaaacgggaaagcaatcaattgccattgatgactgtacattccaccagtgtgtccggcttagcaaatttgactctgagcgcagcatcagctttatacctccagatggagaatttgagcttatgagatatcgaaccacaaaagacatcatcctaccattccgtgtcattcctcttgttcgtgaagtggggcgcacaaagcttgaggtcaaggtggtcatcaaatctaattttaaaccttcacttttggctcagaagattgaggtgaggattccaaccccactcaacaccagtggagtacaggtcatctgtatgaaaggaaaagcaaagtataaggccagtgagaatgccattgtgtggaaaataaagcgcatggctggtatgaaggaatctcagataagtgcagagattgagctgcttcctactaatgataagaagaaatgggctcggcctccaatatccatgaactttgaggtcccgtttgccccatctgggctcaaagtgcgttacctgaaggtgtttgaaccaaaactaaactacagcgaccatgatgtgatcaaatgggtgcgatacattggccgcagtgggatctatgagacacggtgttaatacatcacaaaactcagaaagaagtgggccccgtctcttaacttgcatttctttttattgagaaaaggaagtcaacatgctaaccaaggggtcagaatgggtaggattaaaggtgtgagatagcccttcctttttcccacctgaccataatatccacctttgctccattatacttttaataacaattcttgctgttcccttctttagcattggagagcgttatcatttataagatgcgctctctatgatatggagtatcctctgggccatagctgctatgtggtttcccaataaccacctcccatctagcacagaccaggccgtatcttatctcactcccatctgtgaatattgatgaccgatagtattcttgtatagtgtagtgctttccacaatcatcccaaccttactactcatcatggaactggcagccttcttgggttcaatgttccctagtatttctttcaaatatatacaattttaacactgtcaaaggccagcagagtaggaacaactgggcagaagtttcagagcattgggttcagtatgtggcatgggaggttttgcattgtctcttcatggaataactcaagcactctattatatgtgaccaaataagaggtgagggataagttctacaggtgctcatgttacagctgaaggttgtgtaagaaagtataaattgtgcacttctgtgtcctttagctcctgcagtaacagggagtgtatggatttaaccatatcatagccagttaatcattagtgctggcacaggaatgattttgctatttgtggcagtgtgacttccccctcacatctctgtgctccttgtgttgtgatttgctctgtttttctttgtgacgctcaaactgtacaagtaataaacagcgtagaacacaaaaaaaaaaaaaaaaaaaaa
Translation: MIGGLFIYNHKGEVLISRVYRDDIGRNAVDAFRVNVIHARQQVRSPVTNIARTSFFHVKRSNIWLAAVTKQNVNAAMVFEFLYKMCDVMTAYFGKISEENIKNNFVLIYELLDEILDFGYPQNSETGALKTFITQQGIKSQHQTKEEQSQITSQVTGQIGWRREGIKYRRNELFLDVLESVNLLMSPQGQVLSAHVSGRVVMKSYLSGMPECKFGMNDKIVIEKQGKGTADETGKTGKQSIAIDDCTFHQCVRLSKFDSERSISFIPPDGEFELMRYRTTKDIILPFRVIPLVREVGRTKLEVKVVIKSNFKPSLLAQKIEVRIPTPLNTSGVQVICMKGKAKYKASENAIVWKIKRMAGMKESQISAEIELLPTNDKKKWARPPISMNFEVPFAPSGLKVRYLKVFEPKLNYSDHDVIKWVRYIGRSGIYETRC
Donor tissue: neurula