ORFeome > apex2 – XORFeome 2.0

apex2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis APEX nuclease (apurinic/apyrimidinic endonuclease) 2, mRNA (cDNA clone MGC:79651 IMAGE:6980251), complete cds
Gene Symbol: apex2
Gene ID: 448512
ORF gb_acc: MG133620
ORF ID: 11161

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076676

Library Location

Plate ID: GDExt11011
Well Location: D04

EST Sequences

Clone: MGC:79651 IMAGE:6980251
Trimmed Sequence: ATGAAGATTGTGAGTTGGAACATCAATGGGATCCGGGCAACTCGGGTGGGACTAAAGGAGACGCTGGATTCCCTGGATGCTGATATTATCTGCCTGCAAGAGACTAAAGTCACCAGAGATCTGCTGGATGAACCTTCCGCCATAGTGGAAGGATATAACTCCTACTTCAGTTTTAGCCGTGGGCGGAGTGGTTACTCAGGGGTTGCAACATTCTGCAAGAGCAGCACAACCCCATGGGCAGCTGAGGAAGGGCTCTCCGGCATGTTGTGCAACCATACGGGTTCCATCGGCTGCTATGGAAACACAGAAGAGTTCTTAGAAGAGGAGCTGCAGTCCTTAGACCAGGAGGGCAGAGCAGTACTAACACAACACAGGATCCGAAACTGTGAGGGTAAAGAGGAAACGCTCACTGTGATCAATGTTTACTGCCCTCGCGCTGACCCAGAAAAGCCAGAGCGGAAGACCTACAAACTGCGCTTCTATCGCCTGCTGCAAACGCGTGCTGAGGCCATTTTGCAGAAAGGCGGACATGTGATTATCTTGGGAGACGTTAACACTTCCCACAGGCCTCTCGATCACTGTGATCCGACAGATTTGGAAACCTTTGAGGAGAATCCCGGTCGCCAGTGGCTTAATCAGTTCCTGGGCGATCCTGTCCCATCCCAAAAGGGAGATTCAGAAACAGGCACACCACCTAGTGGTGGATCTGGGCGCTTCTATGACAGTTTCCGATACTTCCACCCTACACAGAGGAACGCCTTCACGTGCTGGTGTTCCGCTTCTGGGGCTAGGCAGACTAATTATGGCACTCGTATTGATTACATCCTGGGAAACAGTGAGCTAGTGGAGAGAGAATTTCTGGATTCAATAATAATGCCAGAGGTGGAAGGGTCAGACCACTGTCCGGTTAAAGCTGTTATGAAATGCAGGCCTATAGCAGCTAACAAATGTCCACCTTTGTGCACCAAGTATCTGCCTGAGTTTGCTGGCCGACAGCAGAAGTTATTGCAGTTTCTGATGAAAAAGGAGAACACTTCAGGCAACGCAACAGAGGAAAGCTCAGAGCTGCTGGGCTCTCAATCATCTGCAGAAGGAGCTGAGATCAGTACTGTACGCAAGCGGGGCTCTGATAAACTGAATGGCACTTCAAGGAAAAAGAACAAAATGGGGACAAATATTGGTCAAGGCAGCCTCCTGAGCTTCTTTAAGCCAGATGGGCAGAAATTAACTGTGGCACCAGAGCACAATCCCAGTGATGTGTCCATTTGTAAAAAGGAGGATACAATGCCCAAAGAATATAAAACCGCTCCTTCTGCAGTTAAATATAACCAGCCACAGGCTGCCTTTTGGAAATCCTTGCTCAAGGGCCCCCCTCCCCCACCCAACTGTAAGGGCCATGGTGAACCCTGTGTTCTGCGGACGGTAAAAAAGGCCGGTCCTAACTGTGGACGCCAGTTTTATGTCTGTGCCCGGCCTGAGGGTCATTCAACAAACCCCCAGGCCAGATGTAACTTTTTCCTCTGGCTCACCAAAAAAGCTGGAGGTGAGGACTGA
Full Trace Sequence: gaaaaattcgataaaagagttgtgtagagccggtgtgatggtctgatcccttaccgatccgcccttgccatatccgggggcgcggagccgagcttgccaccgctggaagcatgaagattgtgagttggaacatcaatgggatccgggcaactcgggtgggactaaaggagacgctggattccctggatgctgatattatctgcctgcaagagactaaagtcaccagagatctgctggatgaaccttccgccatagtggaaggatataactcctacttcagttttagccgtgggcggagtggttactcaggggttgcaacattctgcaagagcagcacaaccccatgggcagctgaggaagggctctccggcatgttgtgcaaccatacgggttccatcggctgctatggaaacacagaagagttcttagaagaggagctgcagtccttagaccaggagggcagagcagtactaacacaacacaggatccgaaactgtgagggtaaagaggaaacgctcactgtgatcaatgtttactgccctcgcgctgacccagaaaagccagagcggaagacctacaaactgcgcttctatcgcctgctgcaaacgcgtgctgaggccattttgcagaaaggcggacatgtgattatcttgggagacgttaacacttcccacaggcctctcgatcactgtgatccgacagatttggaaacctttgaggagaatcccggtcgccagtggcttaatcagttcctgggcgatcctgtcccatcccaaaagggagattcagaaacaggcacaccacctagtggtggatctgggcgcttctatgacagtttccgatacttccaccctacacagaggaacgccttcacgtgctggtgttccgcttctggggctaggcagactaattatggcactcgtattgattacatcctgggaaacagtgagctagtggagagagaatttctggattcaataataatgccagaggtggaagggtcagaccactgtccggttaaagctgttatgaaatgcaggcctatagcagctaacaaatgtccacctttgtgcaccaagtatctgcctgagtttgctggccgacagcagaagttattgcagtttctgatgaaaaaggagaacacttcaggcaacgcaacagaggaaagctcagagctgctgggctctcaatcatctgcagaaggagctgagatcagtactgtacgcaagcggggctctgataaactgaatggcacttcaaggaaaaagaacaaaatggggacaaatattggtcaaggcagcctcctgagcttctttaagccagatgggcagaaattaactgtggcaccagagcacaatcccagtgatgtgtccatttgtaaaaaggaggatacaatgcccaaagaatataaaaccgctccttctgcagttaaatataaccagccacaggctgccttttggaaatccttgctcaagggcccccctcccccacccaactgtaagggccatggtgaaccctgtgttctgcggacggtaaaaaaggccggtcctaactgtggacgccagttttatgtctgtgcccggcctgagggtcattcaacaaacccccaggccagatgtaactttttcctctggctcaccaaaaaagctggaggtgaggactgatattctccatgccaagaatcctggtgtcagacttactggctctttatgccccgtagtttattcttcattccaacagaatgggggggtatgtaccccagctgtgttgttaatgtgcactggaactaaatttagtaaccccagcccctgagaataacatctcagttgctatcaaataatatctgtagcatttatacatgttggtcgttgttctgtgtttgtgtctctgctgtgacattcggcccagacctttgttacctcaatcagaaaaaaacaaaaactgtaaagctcttgtatttatagaaatggcaatttttttaaaccgttttctgcaataaatttttttctaattctaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MKIVSWNINGIRATRVGLKETLDSLDADIICLQETKVTRDLLDEPSAIVEGYNSYFSFSRGRSGYSGVATFCKSSTTPWAAEEGLSGMLCNHTGSIGCYGNTEEFLEEELQSLDQEGRAVLTQHRIRNCEGKEETLTVINVYCPRADPEKPERKTYKLRFYRLLQTRAEAILQKGGHVIILGDVNTSHRPLDHCDPTDLETFEENPGRQWLNQFLGDPVPSQKGDSETGTPPSGGSGRFYDSFRYFHPTQRNAFTCWCSASGARQTNYGTRIDYILGNSELVEREFLDSIIMPEVEGSDHCPVKAVMKCRPIAANKCPPLCTKYLPEFAGRQQKLLQFLMKKENTSGNATEESSELLGSQSSAEGAEISTVRKRGSDKLNGTSRKKNKMGTNIGQGSLLSFFKPDGQKLTVAPEHNPSDVSICKKEDTMPKEYKTAPSAVKYNQPQAAFWKSLLKGPPPPPNCKGHGEPCVLRTVKKAGPNCGRQFYVCARPEGHSTNPQARCNFFLWLTKKAGGED
Donor tissue: tailbud