ORFeome > arbp – XORFeome 2.0

arbp – XORFeome 2.0

General Information

Species: Xenopus tropicalis acidic ribosomal phosphoprotein P0, mRNA (cDNA clone MGC:75771 IMAGE:5381844), complete cds
Gene Symbol: arbp
Gene ID: 394664
ORF gb_acc: MG132932
ORF ID: 10299

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061299

Library Location

Plate ID: GDExt11003
Well Location: B08

EST Sequences

Clone: MGC:75771 IMAGE:5381844
Trimmed Sequence: ATGCCCAGGGAAGACAGGGCTACCTGGAAGTCCAACTATTTCCTGAAAATCATTCAATTGCTGGATGATTATCCAAAATGCTTCATTGTGGGGGCGGACAATGTTGGTTCAAAACAAATGCAGCAGATCCGTATGTCCCTGCGTGGAAAAGCTGTGGTGCTCATGGGAAAGAACACAATGATGCGCAAGGCTATTCGTGGTCATCTGGAAAACAACCCAGCTCTGGAGAAACTTCTATCTCACATCAAGGGTAATGTGGGCTTTGTTTTCACAAAGGAAGATCTTACTGAGGTCAGAGACATGTTGCTGGCAAATAAGGTTCCTGCCTGTGCCCGTGCAGGAGCAATAGCACCTTGCGGGGTCGTTGTGCCCGCTCAGAATACTGGATTGGGCCCTGAAAAGACCTCCTTCTTCCAGGCTTTGGGGATCACCACAAAAATCTCCAGAGGAACCATTGAAATCTTGAGTGATGTGCAGCTGATCAAGACTGGAGATAAAGTGGGTGCCAGTGAAGCCACACTCTTAAACATGTTGAATATTTCCCCATTTTCTTATGGATTAATCATTCAACAAGTGTATGACAATGGCAGCATCTATAGTCCAGAGGTGCTGGATATCACTGAGGAGGCCTTGCATGTTCGCTTCCTTGAGGGTGTTCGTAATGTTGCCAGTGTCTGTCTTCAGATTGGTTATCCCACCGTGGCCTCTGTGCCTCACTCAGTCATCAATGGATACAAGCGTGTCCTTGCCATTGCAGTTGAAACAGACTACAGCTTCCCCCTGGCCGACAAGGTCAAGGCATTCCTGGCAGATCCATCAGCCTTTGTTGTTGCTGCTCCCGCTGCTGACGTGGCTGCTGCTCCTGCTGCTGCTCCTGCTAAGGAGGAAAAGCAAGAAGAGTCTGAGGAATCTGATGATGATATGGGATTTGGTCTCTTTGACTAA
Full Trace Sequence: gtgtgagggaatatctagtctttaaacccttttgtggcaatccttggaagcactgacaagatgcccagggaagacagggctacctggaagtccaactatttcctgaaaatcattcaattgctggatgattatccaaaatgcttcattgtgggggcggacaatgttggttcaaaacaaatgcagcagatccgtatgtccctgcgtggaaaagctgtggtgctcatgggaaagaacacaatgatgcgcaaggctattcgtggtcatctggaaaacaacccagctctggagaaacttctatctcacatcaagggtaatgtgggctttgttttcacaaaggaagatcttactgaggtcagagacatgttgctggcaaataaggttcctgcctgtgcccgtgcaggagcaatagcaccttgcggggtcgttgtgcccgctcagaatactggattgggccctgaaaagacctccttcttccaggctttggggatcaccacaaaaatctccagaggaaccattgaaatcttgagtgatgtgcagctgatcaagactggagataaagtgggtgccagtgaagccacactcttaaacatgttgaatatttccccattttcttatggattaatcattcaacaagtgtatgacaatggcagcatctatagtccagaggtgctggatatcactgaggaggccttgcatgttcgcttccttgagggtgttcgtaatgttgccagtgtctgtcttcagattggttatcccaccgtggcctctgtgcctcactcagtcatcaatggatacaagcgtgtccttgccattgcagttgaaacagactacagcttccccctggccgacaaggtcaaggcattcctggcagatccatcagcctttgttgttgctgctcccgctgctgacgtggctgctgctcctgctgctgctcctgctaaggaggaaaagcaagaagagtctgaggaatctgatgatgatatgggatttggtctctttgactaaaccttgattgttccaagttcataatttaaagacttttacagtctctacttttgctttcagttcttcacacctactgttaactgagaaataaaagcaaaatttatgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MPREDRATWKSNYFLKIIQLLDDYPKCFIVGADNVGSKQMQQIRMSLRGKAVVLMGKNTMMRKAIRGHLENNPALEKLLSHIKGNVGFVFTKEDLTEVRDMLLANKVPACARAGAIAPCGVVVPAQNTGLGPEKTSFFQALGITTKISRGTIEILSDVQLIKTGDKVGASEATLLNMLNISPFSYGLIIQQVYDNGSIYSPEVLDITEEALHVRFLEGVRNVASVCLQIGYPTVASVPHSVINGYKRVLAIAVETDYSFPLADKVKAFLADPSAFVVAAPAADVAAAPAAAPAKEEKQEESEESDDDMGFGLFD
Donor tissue: tadpole