ORFeome > b3galt2 – XORFeome 2.0

b3galt2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2, mRNA (cDNA clone MGC:89037 IMAGE:7005158), complete cds
Gene Symbol: b3galt2
Gene ID: 448276
ORF gb_acc: MG134149
ORF ID: 11779

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075347

Library Location

Plate ID: GDExt11017
Well Location: B05

EST Sequences

Clone: MGC:89037 IMAGE:7005158
Trimmed Sequence: ATGTCATCCTGGAGAAGACGTCATTGCTTCCCTCTTGGGTGGAACTGGCATACCAGGCGCTTCATGTTCCATTGCTTTGTATTACTGGTCCTTTTCTTCTTTATGTTTGTTTTGTTTCATAATAATCGATGGCTTCCGAGGCAGATAATGGACAAAGGAATCATTCAGGTGGATAATACCAATAGTTTCCAGTCAAAGGAAAGTGAAACAATATCAAAGATGCTCCAGAAGTTAGTTGTCTTCAGTCTGAAGAACAATCGGTCTTATCACAAAAAGGTCTTACGTCAAAGAGTGACTACTGCGGAAATTACGTCTAACAGGGTGTCTCAGAATACACTGCATTATGGTTATATAATTAATGAGCCTGACAAATGCCAGAAAAGCACTCCATTTCTCATTCTGCTAATAGCAGTGGAACCACAGCAGCTAAGTGCTCGTGAGGCTATAAGGCAAACTTGGGGAAAGGAAGACCTTTTCCATGGAATTCTGATTGTTAAGTTGTTTTTGCTTGGCAGAGATTCTAAAGGAACGGACAGAACTGACCAGGCAATTGTGGATGAAAGTAACCAATACCATGACATCATCCAGCAGGATTATTTAGACACCTACAACAATCTGACAATTAAAACCCTAATGGGAATGCACTGGATAGCCACTTTTTGTCCAAACGTTTCATATATCATGAAGACAGACAGTGATATGTTTGTGAACACTGAGCACTTAATATACAGGCTTCTGAAGCCTGACGCAGCACCACAAACAAACTATTTCACAGGATATTTTATGAAAGGGTATGCGCCCAATCGTAATAAAAACAGTAAATGGTACATGCCCCCGGAGCTATACCCCGGAGATCTATATCCCCCATTTTGTTCTGGGACAGGCTACGTGTTCTCTGGGGACCTAGCAGAGAAGATATATAAAGTTTCTTTGAGTATTCCACGTTTGCATTTAGAGGATGTATACATTGGTGTTTGTCTTGAAAAATTAGGCATAAAGCCAGTGCCCCCTCCCAAAGAATCTTATTTTAATATTTGGAGGGTTTATTATTCAGATTGTGTGTATAACCAGATAGTCACCTCCCATCAGTTCCAGCCTTCAGAACTACTGAAATATTGGAATCAGTTGCAGCAGAACAGGCATGTCTGTAGCAAAACCCCCAAGTAA
Full Trace Sequence: actatgactgcccgaggcagaaaggttccaaacaagacaagcactacatggattataaccaaaggaagtctaggtataaatagttttattcatttcagatccggacaattctagcatgtcatcctggagaagacgtcattgcttccctcttgggtggaactggcataccaggcgcttcatgttccattgctttgtattactggtccttttcttctttatgtttgttttgtttcataataatcgatggcttccgaggcagataatggacaaaggaatcattcaggtggataataccaatagtttccagtcaaaggaaagtgaaacaatatcaaagatgctccagaagttagttgtcttcagtctgaagaacaatcggtcttatcacaaaaaggtcttacgtcaaagagtgactactgcggaaattacgtctaacagggtgtctcagaatacactgcattatggttatataattaatgagcctgacaaatgccagaaaagcactccatttctcattctgctaatagcagtggaaccacagcagctaagtgctcgtgaggctataaggcaaacttggggaaaggaagaccttttccatggaattctgattgttaagttgtttttgcttggcagagattctaaaggaacggacagaactgaccaggcaattgtggatgaaagtaaccaataccatgacatcatccagcaggattatttagacacctacaacaatctgacaattaaaaccctaatgggaatgcactggatagccactttttgtccaaacgtttcatatatcatgaagacagacagtgatatgtttgtgaacactgagcacttaatatacaggcttctgaagcctgacgcagcaccacaaacaaactatttcacaggatattttatgaaagggtatgcgcccaatcgtaataaaaacagtaaatggtacatgcccccggagctataccccggagatctatatcccccattttgttctgggacaggctacgtgttctctggggacctagcagagaagatatataaagtttctttgagtattccacgtttgcatttagaggatgtatacattggtgtttgtcttgaaaaattaggcataaagccagtgccccctcccaaagaatcttattttaatatttggagggtttattattcagattgtgtgtataaccagatagtcacctcccatcagttccagccttcagaactactgaaatattggaatcagttgcagcagaacaggcatgtctgtagcaaaacccccaagtaaagaacaattctgatcaatgttggggtactgtctgtggggcagcactttctctacagcaagataccttcagggaagggcacttgcaaaggaaaagataatgttaattgccaaataaataaataaggtttatttttgcacattttgatatgttcagcatattacatgacaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSSWRRRHCFPLGWNWHTRRFMFHCFVLLVLFFFMFVLFHNNRWLPRQIMDKGIIQVDNTNSFQSKESETISKMLQKLVVFSLKNNRSYHKKVLRQRVTTAEITSNRVSQNTLHYGYIINEPDKCQKSTPFLILLIAVEPQQLSAREAIRQTWGKEDLFHGILIVKLFLLGRDSKGTDRTDQAIVDESNQYHDIIQQDYLDTYNNLTIKTLMGMHWIATFCPNVSYIMKTDSDMFVNTEHLIYRLLKPDAAPQTNYFTGYFMKGYAPNRNKNSKWYMPPELYPGDLYPPFCSGTGYVFSGDLAEKIYKVSLSIPRLHLEDVYIGVCLEKLGIKPVPPPKESYFNIWRVYYSDCVYNQIVTSHQFQPSELLKYWNQLQQNRHVCSKTPK
Donor tissue: