ORFeome > bccip – XORFeome 2.0

bccip – XORFeome 2.0

General Information

Species: Xenopus tropicalis BRCA2 and CDKN1A interacting protein, mRNA (cDNA clone MGC:69189 IMAGE:5307226), complete cds
Gene Symbol: bccip
Gene ID: 448392
ORF gb_acc: MG133247
ORF ID: 10728

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074611

Library Location

Plate ID: GDExt11007
Well Location: B06

EST Sequences

Clone: MGC:69189 IMAGE:5307226
Trimmed Sequence: ATGGCTTCTAATGCAAAGCGGAGGGCGCTGGAGCCTGAGCGGCTGCCGGAGAGGAATGAGGAAGAGGAGGATGACATGGAAGGGGACAACTCAGACGAGTCCGATGATATTGAAGATGATGAATCGGAGGAAGAGGAAGAAGTGAACGAGGAAGTTAATATAGACTTTGAAGCCTACACAATTTCTGACACTGATTCTGAAGGCATAAAGAAGCTGCTCAAACAGTTGTTCCTGAAAGCCCATGTGAATATCTCCGAGCTAACAGACCTTCTTATTCAGCAGAATCACATTGGCAGCGCCATTAAGCAAGCCGAGAGCCAGGAGGATAGTGATGATGACGATGACGATGACGTAGATCATGTCTTTGGCTTTATAAGTCTTGTGAATCTTACTGAGAGAAAGGGCACCTCGTGCGTGGAACAGATTAAAGAGCTGATTTTGACGCGCTGCGAGGAGAACTGCGAACAGAGCATGGTTGAACAGTTTGATAAAGTTCTAAACAACAACAGCAAGCCTGTGGGTTTCCTCCTAAGCGAGAGATTCATTAATGTACCTGCACAGATTGCTCTGCCCATGCATCAGCAGCTTCAGAAAGAATTGGCAGATACTCAGAGAACCAATAAACCATGCGGGAAGTGTTATTACTATTTAATTCTGAGCAAAACCTTTGTGGAAGCGGCAAAAACATCCAAGGGGAGAGTTGGCTCCCAGGCCAAGGAAGAGCTGATGTTTGCCAATGCAGAAGATGAGTTTTTCTACGAGAAAGCTCTGCTGAAGTTCAGCTACTCGGTGCAGGAGGAGAGCGACACGCAGCTGGGCGGCCGATGGTCCTTCTCCGACGTGCCCATGAAACCCTTGAGGACGGTGATGTTGGTTCCCGCCGACAGGATGAATTCAATCATGGACAAGTTCAAAGAATACCTCTCCGTGTGA
Full Trace Sequence: ggtacagcccagagagcttcctgtttacttccgcattcaagcacgccgcgtagggaaaggcgaacggcatggcttctaatgcaaagcggagggcgctggagcctgagcggctgccggagaggaatgaggaagaggaggatgacatggaaggggacaactcagacgagtccgatgatattgaagatgatgaatcggaggaagaggaagaagtgaacgaggaagttaatatagactttgaagcctacacaatttctgacactgattctgaaggcataaagaagctgctcaaacagttgttcctgaaagcccatgtgaatatctccgagctaacagaccttcttattcagcagaatcacattggcagcgccattaagcaagccgagagccaggaggatagtgatgatgacgatgacgatgacgtagatcatgtctttggctttataagtcttgtgaatcttactgagagaaagggcacctcgtgcgtggaacagattaaagagctgattttgacgcgctgcgaggagaactgcgaacagagcatggttgaacagtttgataaagttctaaacaacaacagcaagcctgtgggtttcctcctaagcgagagattcattaatgtacctgcacagattgctctgcccatgcatcagcagcttcagaaagaattggcagatactcagagaaccaataaaccatgcgggaagtgttattactatttaattctgagcaaaacctttgtggaagcggcaaaaacatccaaggggagagttggctcccaggccaaggaagagctgatgtttgccaatgcagaagatgagtttttctacgagaaagctctgctgaagttcagctactcggtgcaggaggagagcgacacgcagctgggcggccgatggtccttctccgacgtgcccatgaaacccttgaggacggtgatgttggttcccgccgacaggatgaattcaatcatggacaagttcaaagaatacctctccgtgtgaaccgtttccctccaaacagaactatgtacccgaacgccgataacatcatagagactaattaatttttataaacgtgcgcgtacaatcgtagtcattcatttcatcttttgtatccgctgtcggctccggcgagaccacgcaagggttctgggagatttcattagtgtaattaaagacaaggtccctttagagcaggcgttcagtccccggcagggagagagtacaacacagggttcactatatcatttatttgatcagacacagggaggggaggaaaagggttactcggattcctataacatttacaaaaaaagaaatcagttcattaaagttttcctttccttttggacaaaaaaaaaaacaaaaaaaaaaaaaagaaaaaaaaaaaaaaaa
Translation: MASNAKRRALEPERLPERNEEEEDDMEGDNSDESDDIEDDESEEEEEVNEEVNIDFEAYTISDTDSEGIKKLLKQLFLKAHVNISELTDLLIQQNHIGSAIKQAESQEDSDDDDDDDVDHVFGFISLVNLTERKGTSCVEQIKELILTRCEENCEQSMVEQFDKVLNNNSKPVGFLLSERFINVPAQIALPMHQQLQKELADTQRTNKPCGKCYYYLILSKTFVEAAKTSKGRVGSQAKEELMFANAEDEFFYEKALLKFSYSVQEESDTQLGGRWSFSDVPMKPLRTVMLVPADRMNSIMDKFKEYLSV
Donor tissue: gastrula