ORFeome > bcdo2 – XORFeome 2.0

bcdo2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis beta-carotene dioxygenase 2, mRNA (cDNA clone MGC:89365 IMAGE:6988371), complete cds
Gene Symbol: bcdo2
Gene ID: 448408
ORF gb_acc: MG133886
ORF ID: 11473

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075500

Library Location

Plate ID: GDExt11014
Well Location: H03

EST Sequences

Clone: MGC:89365 IMAGE:6988371
Trimmed Sequence: ATGAGGGTGGTGGGCGCATCGCAGTTTTTGAGGAATGGGGCTGCATGCCTGAAGAAACTATTCAATAGGCAGCAAGTATATTTCTCTTCGCAGGCACAAATTGAATGCATAGCTCCCCTTTTCCAGACTGTAGCAGAAACTCCACAGCCAGTACAAGCAGCAGTCTTAGGGACAATACCTGCGTGGATCAATGGCAGTCTCTTACGGAATGGGCCTGGACAGTTTGAATTCGGAGATGACAAATACAATCACTGGTTTGATGGCATGGCTCTTATGCATCAGTTCAAAATTAAGAATGGCTCGGTCACTTATATGAGCAAGTTCCTAGAAAGTGATGTTTACAATGTAAACAAGAGCAAAAATCGAATTGTAGTCTCTGAATTTGGAACTTTGGCATCTTCAGATCCTTGCAAGTCTTTGTATGATCGCTTCATGTCCAAGTTTAAAATAGATTCCACTGACAACTGTAGCGTCAATTATGTGCTGTATAAGGGGGATTATTATGTTAGCACTGAGACCAATTTCATGCGTAAGGTGGACCCAGAGACTCTGAGCACTTTAGAAAAGGTTGACTGGACAAAATTTATTGCTGTAAATGGGGCAACGGCACATCCTCATTATGACCCTGATGGTACTGCATATAACATGGGAAATTCTTATGGAAAGCAAGGAACACGTTACAACATCATTAAGGTACCTGTTCAAAAGTCAGGAACAGAGGAAAATCTAGAAGGTGCACAAGTTATATGCTCCATATTACCACAAAACAAAGGGAAACCTTCCTACTATCATAGTTTTGGAATGACTGAGAATTATGTGATCTTTATAGAGCTACCTCTGAAGTTAAACTTATTGAAAATACTCATCAACCAAATTAAAGGCAAAGCATTTTCAGACATCATGAGCTGGGAGCCAGATCTGCCAACTTTATTCCATGTGGTGAATAAGCACACAGGAGAGCCACATCCCGTGACTTTTTGTGCCCAGCCCTTCATGTCATTTCATCAGATAAATGCCTATGAGGATCAAGACTGCATCGTGCTTGACCTCTGTTCTATGGATGGAGGAGGAGCCATAAACATGTTCAGCCTACAAAATCTTCGCAAATCTGGACAAGCTTTGACTGAGATCTATCAAAAAGTTCCAAAGTCCTACCCACACAGGTTTGTTCTTCCCCTTAATGCTGACACAAACAGTAAACAAGAAACTAAGTACTTAAATTATTCAAGTGCGACTGCTGTCAGAAAAGCTGATGGAAAGGTGTGGTGTACTCATGAAAAGCTACTTGATGACACGCTTAAATATGGCATAGAATTTCCACAGATAAACTATTCTAAATACAACACCAAAAAGTACCGCTACTATTATGCATGTGGATTTCAGCACCTCATTGGAGATTCTCTGGTCAAAGTGGACATTGAGACTAAGCAAACTAAGGTTTGGAAAGAGGAAGGCTTTTACCCTTCAGAACCAATTTTTGTGCCTTATCCAGATTCAGCTGAAGAGGACAATGGAGTCATTCTCTCTGCAGTCCTTACTCCTCATCAGGAAAAAAACATATTCCTGCTTGTTTTGGATGCCAAAGATTTTGTTGAGATTGGTAGAGCTGAAGTGCCTGTTAAGATGCCTTATGGCTTCCATGGAATTTTTTTGCCTCAGAACTCCAAATAA
Full Trace Sequence: gtttctgtcaggtttttgttttgctactaagtcgggtcggtggctgggctatcgctgagcataatgagggtggtgggcgcatcgcagtttttgaggaatggggctgcatgcctgaagaaactattcaataggcagcaagtatatttctcttcgcaggcacaaattgaatgcatagctccccttttccagactgtagcagaaactccacagccagtacaagcagcagtcttagggacaatacctgcgtggatcaatggcagtctcttacggaatgggcctggacagtttgaattcggagatgacaaatacaatcactggtttgatggcatggctcttatgcatcagttcaaaattaagaatggctcggtcacttatatgagcaagttcctagaaagtgatgtttacaatgtaaacaagagcaaaaatcgaattgtagtctctgaatttggaactttggcatcttcagatccttgcaagtctttgtatgatcgcttcatgtccaagtttaaaatagattccactgacaactgtagcgtcaattatgtgctgtataagggggattattatgttagcactgagaccaatttcatgcgtaaggtggacccagagactctgagcactttagaaaaggttgactggacaaaatttattgctgtaaatggggcaacggcacatcctcattatgaccctgatggtactgcatataacatgggaaattcttatggaaagcaaggaacacgttacaacatcattaaggtacctgttcaaaagtcaggaacagaggaaaatctagaaggtgcacaagttatatgctccatattaccacaaaacaaagggaaaccttcctactatcatagttttggaatgactgagaattatgtgatctttatagagctacctctgaagttaaacttattgaaaatactcatcaaccaaattaaaggcaaagcattttcagacatcatgagctgggagccagatctgccaactttattccatgtggtgaataagcacacaggagagccacatcccgtgactttttgtgcccagcccttcatgtcatttcatcagataaatgcctatgaggatcaagactgcatcgtgcttgacctctgttctatggatggaggaggagccataaacatgttcagcctacaaaatcttcgcaaatctggacaagctttgactgagatctatcaaaaagttccaaagtcctacccacacaggtttgttcttccccttaatgctgacacaaacagtaaacaagaaactaagtacttaaattattcaagtgcgactgctgtcagaaaagctgatggaaaggtgtggtgtactcatgaaaagctacttgatgacacgcttaaatatggcatagaatttccacagataaactattctaaatacaacaccaaaaagtaccgctactattatgcatgtggatttcagcacctcattggagattctctggtcaaagtggacattgagactaagcaaactaaggtttggaaagaggaaggcttttacccttcagaaccaatttttgtgccttatccagattcagctgaagaggacaatggagtcattctctctgcagtccttactcctcatcaggaaaaaaacatattcctgcttgttttggatgccaaagattttgttgagattggtagagctgaagtgcctgttaagatgccttatggcttccatggaatttttttgcctcagaactccaaataaatatagaacttgactgaaaggaaattactgaaattatataaaatcaatagcctttgatcaaattaacaagcttatattaacaagaacaatgagggttgttgtactgttagaacacagtgcaagtggacagttggcaagcaccctaaaattatctactagtgtctagcattggtgacctcattgtgcctattactgcggagtgcaaggtgcaacaagctaaacacaagaatgccctgcacgttgaccagggcttccttttctccttacacctgcctggtctctctttttgataaactgtgaacattgtatatcctgtaccctgtacatcatttgcatgttactcttggcagggataattatcatcaaagcactgttttctggagggaaaaaacatggtggattgtactgaatttttgcatatagcaatttatagtaaatgagaccttgatacctttaaattccattaaatttagatttgtcataaaaaaaaaaaaaaaaaaaaaaaaaataaaaaaaaaaagaaaaaaaaaaaaaaaaaaaaa
Translation: MRVVGASQFLRNGAACLKKLFNRQQVYFSSQAQIECIAPLFQTVAETPQPVQAAVLGTIPAWINGSLLRNGPGQFEFGDDKYNHWFDGMALMHQFKIKNGSVTYMSKFLESDVYNVNKSKNRIVVSEFGTLASSDPCKSLYDRFMSKFKIDSTDNCSVNYVLYKGDYYVSTETNFMRKVDPETLSTLEKVDWTKFIAVNGATAHPHYDPDGTAYNMGNSYGKQGTRYNIIKVPVQKSGTEENLEGAQVICSILPQNKGKPSYYHSFGMTENYVIFIELPLKLNLLKILINQIKGKAFSDIMSWEPDLPTLFHVVNKHTGEPHPVTFCAQPFMSFHQINAYEDQDCIVLDLCSMDGGGAINMFSLQNLRKSGQALTEIYQKVPKSYPHRFVLPLNADTNSKQETKYLNYSSATAVRKADGKVWCTHEKLLDDTLKYGIEFPQINYSKYNTKKYRYYYACGFQHLIGDSLVKVDIETKQTKVWKEEGFYPSEPIFVPYPDSAEEDNGVILSAVLTPHQEKNIFLLVLDAKDFVEIGRAEVPVKMPYGFHGIFLPQNSK
Donor tissue: gastrula