ORFeome > bin1 – XORFeome 2.0

bin1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis bridging integrator 1, mRNA (cDNA clone MGC:76187 IMAGE:5335824), complete cds
Gene Symbol: bin1
Gene ID: 394839
ORF gb_acc: MG132694
ORF ID: 9985

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063216

Library Location

Plate ID: GDExt11001
Well Location: B01

EST Sequences

Clone: MGC:76187 IMAGE:5335824
Trimmed Sequence: ATGGCTGAGCTCGGCAAGGGAGTCTCTGCGGGCAAAATAGCCAGCAATGTGCAGAAGAAGCTGACCCGGGCCCAGGAGAAGGTCCTTCAGAAACTGGGAAAAGCCGATGAAACAAAAGATGAGCAGTTCGAGCAGTGTGTGCAGAACTTCAACAAGCAGCTGACAGAAGGATCCAAACTCCAGAAGGATCTCAGAGCCTATTTGGCGTCGGTAAAAGCGATGCACGAGGCCTCCAAGAAGCTGACGGAATGTTTGCTGGATGTGTATGAGCCGGACTGGCCAGGGAGGGAGGAGACCAACAAGATCGCCGAGAACAATGACCTTCTCTGGACCGACTATCATGAGAAGCTGGTGGATCAGGCCCTGCTCACCATGGACACCTACCTCGGCCAGTTCCCTGATATCAAGTCGCGCATCGCTAAGCGTGGGAGGAAACTGGTGGATTACGACAGCGCCCGCCATCACTTCGAGTCCCTACAGAATGCGAAAAAGAAGGACGAAACTAAAATCGCCAAGGCCGAGGAGGAGCTGCTAAAAACCCAGAAAGTGTTTGAAGAGATGAACGCTGATTTACAGGAGGAGCTGCCTTCTCTGTGGAATAGCCGTGTTGGTTTCTATGTCAACACATTCCAGAGTATCGCTGGGCTGGAGGAGAATTTCCATAAGGAGATGGGCAAGCTGCACCAGGGCCTCAATGACGTGATGGTGACTTTGGAATCGGAGCAGGGAAACCTCTCGACGAACTCCTCCAGTGTTAAAGTTCAGCCAAGAAAGAAAATGAACTTGTTCTCCCGCCTGAGGATAAAGAAGGGCAGTGAAACGACCCCCACGAAGACGAACAAGAGCCCGTCCCCACCTGCCACCGACGGGCCACCGGCCGTGTCTGAAACAAAGGCTGTCAACCATGACTTCGAAGAGCGCTCTGCCCCTGCCGAGGAGACGCCATCTGTGGTCATATCCAAGTCACCATCACAGCTGAGGAGAGGCCCCCCGGTTCCGCCTCCGCCAAAAGTCACGCCGTCCAAGGACTTCAAGCAAGAGAATATACTCAGTCTGTTTGATGACAGTTTTGTGCCAGAGATAAGTGTGACCACGCCTTCACAGCCAGTGGAGCCGGCCCCAGCCCCGGTGCCTGTAACCGAACCGGCCAAGAAGGAAACAGAAGTAAAACTTGAATCTCCTCCATCTGAAGAGGTGCCTGATAAGTCCCCGAGCTCCCTTCCTGCTGTGGTGGTGGAAACCTTTTCTGCTACGGTCAATGGAACTGTGGAGTCCAGCCCCCCAAAAGCAGAGATGCCCCCTGGCTTCCTGTATAAGGTCAGAGCCCAACATGATTACGCTTCCACCGACAGCGACGAATTAAACTTAAAAGCCGGTGACATGGTTCTGGTGACTCAGTTTGAAAACCCAGATGAGCAGGATGACGGCTGGCTCATGGGAATCAAAGAGACGGACTGGCTGCAGAATAAGCCATTTGAACAGCACCGAGGGGTCTTCCCAGAGAACTTTACGGAGAAGAACCTGTGA
Full Trace Sequence: tgattattgtacgggcagctccggctacagggaaggcaagatggctgagctcggcaagggagtctctgcgggcaaaatagccagcaatgtgcagaagaagctgacccgggcccaggagaaggtccttcagaaactgggaaaagccgatgaaacaaaagatgagcagttcgagcagtgtgtgcagaacttcaacaagcagctgacagaaggatccaaactccagaaggatctcagagcctatttggcgtcggtaaaagcgatgcacgaggcctccaagaagctgacggaatgtttgctggatgtgtatgagccggactggccagggagggaggagaccaacaagatcgccgagaacaatgaccttctctggaccgactatcatgagaagctggtggatcaggccctgctcaccatggacacctacctcggccagttccctgatatcaagtcgcgcatcgctaagcgtgggaggaaactggtggattacgacagcgcccgccatcacttcgagtccctacagaatgcgaaaaagaaggacgaaactaaaatcgccaaggccgaggaggagctgctaaaaacccagaaagtgtttgaagagatgaacgctgatttacaggaggagctgccttctctgtggaatagccgtgttggtttctatgtcaacacattccagagtatcgctgggctggaggagaatttccataaggagatgggcaagctgcaccagggcctcaatgacgtgatggtgactttggaatcggagcagggaaacctctcgacgaactcctccagtgttaaagttcagccaagaaagaaaatgaacttgttctcccgcctgaggataaagaagggcagtgaaacgacccccacgaagacgaacaagagcccgtccccacctgccaccgacgggccaccggccgtgtctgaaacaaaggctgtcaaccatgacttcgaagagcgctctgcccctgccgaggagacgccatctgtggtcatatccaagtcaccatcacagctgaggagaggccccccggttccgcctccgccaaaagtcacgccgtccaaggacttcaagcaagagaatatactcagtctgtttgatgacagttttgtgccagagataagtgtgaccacgccttcacagccagtggagccggccccagccccggtgcctgtaaccgaaccggccaagaaggaaacagaagtaaaacttgaatctcctccatctgaagaggtgcctgataagtccccgagctcccttcctgctgtggtggtggaaaccttttctgctacggtcaatggaactgtggagtccagccccccaaaagcagagatgccccctggcttcctgtataaggtcagagcccaacatgattacgcttccaccgacagcgacgaattaaacttaaaagccggtgacatggttctggtgactcagtttgaaaacccagatgagcaggatgacggctggctcatgggaatcaaagagacggactggctgcagaataagccatttgaacagcaccgaggggtcttcccagagaactttacggagaagaacctgtgaggagagagagacggctcctttctccgtgggatttcaagctaattttctgtgaaaatgaagaacacctgccctatgaacaaagtcagaaggaatctttatccttagtgtccacttaaaggtccggttttcttacaggcgcaaggttacaaattaaactccaccccattgtcaggaacggtgaaatgttcctatccccacagctgggccaccggaacgtcacctttggctgatccaagaaccccttgaactgtagcaggagatgcaccatgttaggacaatctcaacaccttgtgtgtctgtaacaaatgtaccccaatgattagccaatagaggtagtgtctgtcgtggttccgtacatgggctccattcataacaatgttgttgctcaataagggcagtcaggtgcaatattttccctggttctttccataatctccggcattctctaggcaagattagggtgcttcccgtgggtgccacgttgaacccattgtatcgtttgctgtctgtcagccttgatcattactatttgagacttgaaatctaaaaacaatatattttatctagttgtagaacgtaatgtccaccagatctccaatgtgtatgaaattgcggtgaaagctccgtctttatagacatttcattaaataccattcattgatgtggtagatgttgaccttccttaggcagagctgacaaattgccccttttttaattcaaatggatacgcgctgccgtgtttacttttggagcacaggttctgatacggatctgacccatctttgtggcaccggattcaatcggattccctgtctgcgctgagttaataaaatcccctttctcttaattaagtttggctcaaagaactgttcgaatgttttgctttcttggccgttagtttcggcctacgttgtgcccattgttgtgtccagtttttgtatttgggccagaattttaatgactgcacaagaatctgtgggatatagaagataatgatagcctctaatgatagcctctaaagctggccatacacgttaagatttttataagatccattcgtcatcgtaggacctgaatcgatctattgtccatcaacgaaagcgaccattccatacgatatcttctagttcagggatccccaacctttcttactcgggagccacagtcaaatgtaaaaagacttggagagcaacacaagcaccataaaagttcatggaggagccaaataagggctgtgattggctattaggggcctctatgcaccctatcagcttacagggggctttatttggtaggaaatcttgtttttattcaaccaaaacttgcccccaagtcaggaattcagaaataactccctggtttgggggcactgagagcaacacccaaggggttggggagcaacatgttgcccctgagccactggttggggatcactgttctagttgaagctggaaaactacctgcttggtcgtgccaaaccattggacaacgggctaatgacgcaaatgttcaaacctgcccgattgattttgatctagggatgaaaaatccctagatctgtgatcgttctgtgcccactaatttacgataatttggcgtatttgtcagattgcaccgaaattggtcattagggagagaaaactcaacgtgtatggccaccttaaggtcataagatgtatctaccatgtgattgggcgactgtacagtgaaagcaccaattacaaaaggctaagacacgtcatgtcatctatgaatcccactaataacttatatttcagaagataaaaattcaataaacccttgtttattgcccttcccccccccttcagaatctgaaatttcaaggtaaaattagcagattattttagtttttttcttcatttgtgtgtttattgaatttgggaattgtgatttcatactgtgacggtgagttgtgagatggtaacggtgtgtggtttaggcatggggggggggggtatgaatgtgtaaatgtgtcgctcctgggggtcctgccatgtattaatatagtgattgcacaactcgaaggagataatgtgtttattttgaattctggtattgttttccttatcaacactataaactgtaatatagtaatggctaaattggctgatggtttgtgaaggggatgtttctactttggtgtttctcctatttactttttttttttaaatataatgttaaacttaggttccaccttctaaataattctttggttctctgtgtctcagctgaggcaagcaccatgtcagctcccacccatatgtatagatacaaatatacagagaaggaatgttctgggcacacaataagctgtacccccatactgtactgtctaagggaaacactatggcacctcctacccatatgtataaatacaaatatacagagaaggaatgttctgggcacacaataagctgtacccccatactgtactgtctaagggaaacactatggcaccccctacccatatgtataaatacaaatatacagagagggaatgttctgggcacacaataagctgtacccccatactgtactgtctaagggaaacactatggcacctcctacccatatgtataaatacaaatatacagagagggaatgttctgggcacacaataagctgtacccccatactgtactgtctaagggaaaaactatggcacctcctacccatatgtataaatacaaatatacagagaaggaatgttctgggcacacaataagctgtacccccatactgtactgtctaagggaaacactatggcaccccctacccatatgtataaatacaaatatacagagagggaatgttctgggcacacaataagctgtacccccatactgtactgtctaagggaaacactatggcaccccctacccatatgtataaatacaaatatacagagagggaatgttctgggcacacaataagctgtacccccatactgtactgtctaagggaaacactatggcaccccctacccatatgtataaatacaaatatacagagagggaatgttctgggcacacaataagctgtacccccatactgtactgtctaagggaaacactatggcaccccctacccatatgtataaatacaaatatacagagagggaatgttctgggcacacaataagctgtacccccatactgtactgtctaagggaaacactatggcaccccctacccatatgtataaatacaaatatacagagagggaatgttctgggcacacaataagctgtacccccatactgtactgtctaagggaaacactatggcaccccctacccatatgtataaatacaaatatacagagaaggaatgttctgggcacacaataagctgtacccccatactgtactgtctaacggaaacactatggcacctcctacccatatgtataaatacaaatatacagagaaggaatgttctgggcacccagtataggccgtacccttatactgtctaagggaaatatggaagctgtgacttatatgtgtaaataaaattaaagtgagaaggaatgttctgtaatccgaaaggaaagggttgtagctacaaaattcttatttataagggattatcttctcccctgtaccatactgttgtcctgttgcatctcatagagagtagggttagtagctatgctggcatagtatcatggtttctcttgctctgggcaatgagaaacctgaagcagatatacctgtaggagaccataaatgtttggttccaagcagcagatatctcctcccttgccaatgtcttgcaatgggattatagaacaagaggagtgttatggggagagccacacacactggactaggactcacatggattgttcatatttagcatttcttacagcgctgggagttgtagttgaagctcagggggatggccactggtggctcattcttcatttctatgaaagggtagagaggactgtgtcttccctccctctctgttcctaagggcaaatgtgcaacgatgcatgtgagaaaaccttccttagcaacacacacgtttgggtacatggaaaaagcccatggagtaacgctggggggcaaacggaatcacttaacccatcccaggaatattccttttggtagcagatacaaaatcagagaaggatgtgtcgggaaatgaatggccaagtccttcagttgctcagacgtggtcaaaatggaatccaggattccatattctgatggaagagccttggtgggcagatcagagggaccaagcgattccatacacagtattagtatctctgtagatgggacttggaagaaattccactccgtagggcagcggttctcaacctgtgggggtggaacgaccctttcacaggggttgcccaagaccatcggaaaacacatatttccaatggtcttaggaaccgagacaccgctcctctatggttgggggtcaccacaacatgaagaactgtattaaagggtggtggccactgccatggtggaacagcgaggcccttcgctccgttgagcactttgctgttattagaattggccagggccatgtaaagatccccataccccggccgatagtagctgctgatatgggtcccttggactgattcgtcagcttatcgggccgtgtatgggcacacttggcgacatcaccaagcaagcggatcttaagatgtatggggaccttaattgagtgaataattggctcaccctatggctacagttggccatcgctctactaaagggcgatccttctgctgttgtcggaagtttttagtgacccgtagagccttgtggtccgatatcccggcccaaaagaggagcgaacccaaatagaacccatgttctattgacggcatgacggtacagcctatggcgtcctcagagcttattcctttgtaggcctatggcgtcctttgtattagaattgatgggtgggagttggtcagtagtttccctgagccagtactgtaggaaggtattgattatttcatgcatcgtatttatatacatgggtgggagctgccacactgcctgcctcagccgaaaggcctatgtcggccatcgtatccagagttaatctgtgtatgttattactgtatgtatttgcccataaacaccagataattgccccccccccgacgcctgacattaccttctgccccgtgagggggctcgctctaaagaaactgtacctttaaggattcatttgaaagaagaagtgtattttttaggcaaaatattaaaaagtcgccgttttcaagccaggaccgctatcgataccgcgttctatttttttgtgtttaagtttaaaaaaaactgaaagaaatattttaatactgttgggaaaacaaaatgctgcatgaatttattgtgattagttaggaaacgagatatatagagatatatttaaagagaaacacaggtgataatgttcctctctctccccattggtcacattattttatagagttttgtcaccttgatggatgccccgcccttttattactggatcgtgaaggcgcattcgttcttttcagaaacatttccgatcgtccaatcatagggcctgttcttgtgcaactccgcccatttgttgtttccgtttctcgtttctgtatcagactgaatgcaccttcacgtgatttattttatgtttaactcccccattgataccagtgttgcccctcgctattgtgttgttgcaaaagcagcctgtagggggagttccaaacccccccgtctcctatttattgtaggtactccgctttacttgaacgagtagaggccgcaggctgcctgttgctatggaatacttgttaccatgataggttggttttccggttgagacgatatattgggcgtatatatatatatacatgtaactatagccttggctggaatcctgtatttatgaccatcgctcaataaaagtcacccagctatttaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAELGKGVSAGKIASNVQKKLTRAQEKVLQKLGKADETKDEQFEQCVQNFNKQLTEGSKLQKDLRAYLASVKAMHEASKKLTECLLDVYEPDWPGREETNKIAENNDLLWTDYHEKLVDQALLTMDTYLGQFPDIKSRIAKRGRKLVDYDSARHHFESLQNAKKKDETKIAKAEEELLKTQKVFEEMNADLQEELPSLWNSRVGFYVNTFQSIAGLEENFHKEMGKLHQGLNDVMVTLESEQGNLSTNSSSVKVQPRKKMNLFSRLRIKKGSETTPTKTNKSPSPPATDGPPAVSETKAVNHDFEERSAPAEETPSVVISKSPSQLRRGPPVPPPPKVTPSKDFKQENILSLFDDSFVPEISVTTPSQPVEPAPAPVPVTEPAKKETEVKLESPPSEEVPDKSPSSLPAVVVETFSATVNGTVESSPPKAEMPPGFLYKVRAQHDYASTDSDELNLKAGDMVLVTQFENPDEQDDGWLMGIKETDWLQNKPFEQHRGVFPENFTEKNL
Donor tissue: tailbud