ORFeome > calu – XORFeome 2.0

calu – XORFeome 2.0

General Information

Species: Xenopus tropicalis calumenin, mRNA (cDNA clone MGC:76276 IMAGE:5379293), complete cds
Gene Symbol: calu
Gene ID: 395023
ORF gb_acc: MG132788
ORF ID: 10110

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064883

Library Location

Plate ID: GDExt11002
Well Location: B03

EST Sequences

Clone: MGC:76276 IMAGE:5379293
Trimmed Sequence: ATGAGATCTCTGCCTGTGTTCCTGCTTGTGACCCTCTGTGTCTCCTGGGTTATGGGGGTACCGACCAAGGAGAAGAAAGACCGTGTTCATCACAGTAAGGACCTGAGTGATCACGAACATGATGACCAGAAGGGTTTCCAGTACGACCACGAGGCCTTTCTAGGCAAGGAAGAAGCCAGGACCTTTGATCAGCTCACCCCAGAAGAGAGCCAACACAGACTGGGGAAGATAATTGACCAAATGGACAAAGACAATGACAAATATATCACATCGGGTGAACTGTTTGCCTGGATAAAACATGTGAGTAGGCGTTGGAATCTAGAAGATTCAGAGAAACAGGGGAAGAAGTACGATACCAACAAGGATGGGATGATCTCTTGGGACGAGTATGCTAAGGGGGTGTATGGACACCTGCTAGGCAAAGGGGAAGAATTCTATGACGTGGCAGATAAGGATAAGGAGCGCTACAGGAAGATGATGATGCGGGATGAGCGGCGGTTCAAGGTGGCAGATAAGGATGGTGATCTGATTGCCACTCGGGAAGAGTTTACTGCATTCCTGCACCCAGAGGAATATGGCTACATGCAGGATATTGTGATAACGGAAACCATCGAGGACATTGATAAGAATGACGACGGCATTGTGGATGTGCATGAGTACATAGCTGACATGTACACCCCTAATGAAGATGAGCCAGAACCAGATTGGGTGAAGACCGAGCGTCAGCAGTTCACAGATTTCCGCGACATAAACAAGGACGGGAAGATGGACCGAACAGAAATCAGCCAGTGGATCCTCCCCCATGACTACGACCATGCTGACCTGGAAGCCAAGCACCTGGTCTATGAATCTGACAAAGACAAGGATGGGAAACTGACCAAAAAGGAAATCTTGGACAACTGGAACATGTTCGTTGGTAGCCAGGCGACAAACTACGGCGAAGATCTAACGCGGCGACATGATGAATTTTGA
Full Trace Sequence: gtgaagcgacagctgaagagcgccacaatgagatctctgcctgtgttcctgcttgtgaccctctgtgtctcctgggttatgggggtaccgaccaaggagaagaaagaccgtgttcatcacagtaaggacctgagtgatcacgaacatgatgaccagaagggtttccagtacgaccacgaggcctttctaggcaaggaagaagccaggacctttgatcagctcaccccagaagagagccaacacagactggggaagataattgaccaaatggacaaagacaatgacaaatatatcacatcgggtgaactgtttgcctggataaaacatgtgagtaggcgttggaatctagaagattcagagaaacaggggaagaagtacgataccaacaaggatgggatgatctcttgggacgagtatgctaagggggtgtatggacacctgctaggcaaaggggaagaattctatgacgtggcagataaggataaggagcgctacaggaagatgatgatgcgggatgagcggcggttcaaggtggcagataaggatggtgatctgattgccactcgggaagagtttactgcattcctgcacccagaggaatatggctacatgcaggatattgtgataacggaaaccatcgaggacattgataagaatgacgacggcattgtggatgtgcatgagtacatagctgacatgtacacccctaatgaagatgagccagaaccagattgggtgaagaccgagcgtcagcagttcacagatttccgcgacataaacaaggacgggaagatggaccgaacagaaatcagccagtggatcctcccccatgactacgaccatgctgacctggaagccaagcacctggtctatgaatctgacaaagacaaggatgggaaactgaccaaaaaggaaatcttggacaactggaacatgttcgttggtagccaggcgacaaactacggcgaagatctaacgcggcgacatgatgaattttgatggacttgttccctagttcctacatgtcagcatattgctggccttctttaccttgtcttatggtggcagaagcctagggtctctgccgccatatttatttgtttgtcttgagggttttttttttcttttttttttatatgcaaattttttcacctagaaacaattaatgtgaaaggctcaggaatctaatgagtatggaagtggggtgggtgtggtcaaacagcgtgtatatatctctttatttctaagggcaaaacagaccacttctgggcagagcaactccctatttatgccattcctagctccatagcaacactatggccccataatcaggtgggagcttgggttacatttctatggtaatgtcccttataagttataaaggagtttgtttgagaaccctaatgattttacaggaaatctgtcggccactagcatttagtaggccacccataggctctcctttcactagctggatgctgaagaggtatgagagtttaaagctgcagtacctcattacacataaaatgggtgggggggatgagagtaacatcgtaagaatgcagagatctgttactggccgcacactatcctgaacagagagttgtaatggggtgataggagcgccatctggtggcaagcaggtaaatctggaaaagcgaaagctgaataaaaagtgaaatcactcaaattccataaagaaatgaatgctgattgtgcccgagtatcactgtgtacatcatggtaaactaccaatttaaaatgtaggggcatattcagtctaatggaagctgtagggggcaaaaggctgcaactgtcatttattcacaacagtgcccccttctatcaactgcagtggatgtgatttttgtcttctatatttacaccatggtaaaattgagccctgatgttaacagttggggccactaaacaaaaggcccaattattcaaaataaaataaaaaaacacggagggctctgctacactggtgtgtccccttaggctggctgtggccctgtgccgtctccactgagagaccttcctgctccaatcaccaacccgcctggcacaagcacagtcagtagcaaccataggaacaccattgtagccgagtctctctctaggtcacaccactgcacttttagccatttgtaattctgtgtgtttggtgcttttgtatacaaacatccaataaaaatgtaaaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MRSLPVFLLVTLCVSWVMGVPTKEKKDRVHHSKDLSDHEHDDQKGFQYDHEAFLGKEEARTFDQLTPEESQHRLGKIIDQMDKDNDKYITSGELFAWIKHVSRRWNLEDSEKQGKKYDTNKDGMISWDEYAKGVYGHLLGKGEEFYDVADKDKERYRKMMMRDERRFKVADKDGDLIATREEFTAFLHPEEYGYMQDIVITETIEDIDKNDDGIVDVHEYIADMYTPNEDEPEPDWVKTERQQFTDFRDINKDGKMDRTEISQWILPHDYDHADLEAKHLVYESDKDKDGKLTKKEILDNWNMFVGSQATNYGEDLTRRHDEF
Donor tissue: tailbud