ORFeome > cdc20 – XORFeome 2.0

cdc20 – XORFeome 2.0

General Information

Species: Xenopus tropicalis cell division cycle 20 homolog, mRNA (cDNA clone MGC:75919 IMAGE:5383703), complete cds
Gene Symbol: cdc20
Gene ID: 394542
ORF gb_acc: MG132985
ORF ID: 10366

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061363

Library Location

Plate ID: GDExt11004
Well Location: H11

EST Sequences

Clone: MGC:75919 IMAGE:5383703
Trimmed Sequence: ATGGCGCAGTTTGCATTTGAAACTGACATTAATAGTATCTTGAAATTGGATACACCTATCACAAATGCTCCTCTAGCAAGATGGCAGCGGAAAGCAAAGGAGGGTAACTGCTCTTCATTGAATACTTCTGCAAATACGAGTACAATGTCCCCAATGAAAACGTCAAATCGATCCCACAGTTCCAGCAAAACTCCCTCAAAAACTCCAGGAAAATCTGGTCCAAAAATGCAAGGTACTCCTTCCAGAGCTGGAGGTGATCGTTTCATTCCCAACCGCAGTGCAATGCAGATGGATGTTGCTAGCTTTCTTCTGTGCAAAGAGAATGAGCCAGCTGATACTTCACCCACAAAAAAGGAGCAGCAAAAAGCCTGGGCAATGAATCTTAATGGTTTTGATATGGAAGAGGCAAAAATTTTGCGACTTGGTGGTAGACCTCAAAATGCTCCTGAAGGATATCAGAATAACTTGAAAGTGCTGTACAGCCAAAAAACCACCCCAGGTTCCAGTAAGAAAACGGGCAGATATATACCTTCCATGCCAGACAGGGTCCTGGATGCTCCAGATATCCGGAACGATTACTATCTCAATCTGATTGACTGGAGCTCTCAGAACTTCCTTGCTGTTGCATTAAATGACTCTGTTTATCTTTGGAATTATGCAACTGGAGATATAATACTGCTGCTACAGATGGAGCATTCAGAAGAATATATATCCTCTGTATCATGGATCAAGGAAGGCAATTACCTGGCAGTGGGTACTAGTAATTCAGAAGTGCAGTTATGGGATGTTCAGCAGCAGAAACGTCTCCGTAATATGACCAGCCATTCATCCCGTGTTGGAGCTTTGAGTTGGAACAACCATATCCTTTCCAGTGGTTCACGGACAGGACATATTCATCACCATGATGTCAGAGTTGCTCAGCATCATGTATCCACACTAACAGGTCATACTCAGGAGGTGTGTGGCCTTAAATGGTCTCCAGATGGCCGCTATCTTGCCAGTGGTGCAAATGACAACTTGGTAAATGTATGGCCTTGTGTTCAAGGAGATTCAGGGGAGTTTTCACCAGTACAAACATTTACACAACATCAAGGAGCTGTTAAGGCTGTGGCATGGTGCCCATGGCAATCCAATGTGCTAGCAACTGGTGGGGGAACAAGCGACCGGCACATTAGAATCTGGAATGTTTGCTCTGGAACCTGCTTAAATTCTGTTGATACCCATTCACAGGTGTGTTCCATACTATGGTCTACAAATTACAAAGAATTGATATCTGGCCATGGATTTGCTCAGAATCAGCTTGTATTGTGGAAATATCCAACTATGACAAGAGTGACAGAACTTAAAGGTCACACTGCTCGGGTGCTTAATCTAGCAATAAGCCCAGATGGCTGCACAGTGGCTTCTGCTGCCGCTGATGAAACTCTGCGATTGTGGAAGTGCTTTGAGGTGGATCCTGTCACAAAGAAAGAAAAGGAAAAGGCCCGTAGCAGCAAGAGCATCATTCACCAAAGCATCAGATGA
Full Trace Sequence: taactggtaagctattctttagctggctaagggttacagaagcatacagacgccgggctttgcgatttctgtactcatggcgcagtttgcatttgaaactgacattaatagtatcttgaaattggatacacctatcacaaatgctcctctagcaagatggcagcggaaagcaaaggagggtaactgctcttcattgaatacttctgcaaatacgagtacaatgtccccaatgaaaacgtcaaatcgatcccacagttccagcaaaactccctcaaaaactccaggaaaatctggtccaaaaatgcaaggtactccttccagagctggaggtgatcgtttcattcccaaccgcagtgcaatgcagatggatgttgctagctttcttctgtgcaaagagaatgagccagctgatacttcacccacaaaaaaggagcagcaaaaagcctgggcaatgaatcttaatggttttgatatggaagaggcaaaaattttgcgacttggtggtagacctcaaaatgctcctgaaggatatcagaataacttgaaagtgctgtacagccaaaaaaccaccccaggttccagtaagaaaacgggcagatatataccttccatgccagacagggtcctggatgctccagatatccggaacgattactatctcaatctgattgactggagctctcagaacttccttgctgttgcattaaatgactctgtttatctttggaattatgcaactggagatataatactgctgctacagatggagcattcagaagaatatatatcctctgtatcatggatcaaggaaggcaattacctggcagtgggtactagtaattcagaagtgcagttatgggatgttcagcagcagaaacgtctccgtaatatgaccagccattcatcccgtgttggagctttgagttggaacaaccatatcctttccagtggttcacggacaggacatattcatcaccatgatgtcagagttgctcagcatcatgtatccacactaacaggtcatactcaggaggtgtgtggccttaaatggtctccagatggccgctatcttgccagtggtgcaaatgacaacttggtaaatgtatggccttgtgttcaaggagattcaggggagttttcaccagtacaaacatttacacaacatcaaggagctgttaaggctgtggcatggtgcccatggcaatccaatgtgctagcaactggtgggggaacaagcgaccggcacattagaatctggaatgtttgctctggaacctgcttaaattctgttgatacccattcacaggtgtgttccatactatggtctacaaattacaaagaattgatatctggccatggatttgctcagaatcagcttgtattgtggaaatatccaactatgacaagagtgacagaacttaaaggtcacactgctcgggtgcttaatctagcaataagcccagatggctgcacagtggcttctgctgccgctgatgaaactctgcgattgtggaagtgctttgaggtggatcctgtcacaaagaaagaaaaggaaaaggcccgtagcagcaagagcatcattcaccaaagcatcagatgaacaaactttgctttttgtttttaaatttgtgcataatgtatattttttatatattctgaaataaagtcttaaagttgtataatttacactgtttgatactggagaagcacctgtctacctgttgtattggcctgtaacagttctaaccctattgccacttctgcaaataagtctagttactgcttgtgcccagacctgtgtagtctttgacattactggatgaaactaaaggttttcaatttgtatttggtcttcttgactgtcttttcattcagtcataatgtttttaatcttcaacaagcatacaaacaatgcaatggatagggaaactgaatgactgactggtaattaactttaagcagcagtttgtgcatgtggccaatcattgggcgttatggaatgctgcttgtccaccctcactaatgtataaggctggttcaactgttgtaataaaactgtaaatatgcactaaaaaaaaaaaaaaaaaaaaaa
Translation: MAQFAFETDINSILKLDTPITNAPLARWQRKAKEGNCSSLNTSANTSTMSPMKTSNRSHSSSKTPSKTPGKSGPKMQGTPSRAGGDRFIPNRSAMQMDVASFLLCKENEPADTSPTKKEQQKAWAMNLNGFDMEEAKILRLGGRPQNAPEGYQNNLKVLYSQKTTPGSSKKTGRYIPSMPDRVLDAPDIRNDYYLNLIDWSSQNFLAVALNDSVYLWNYATGDIILLLQMEHSEEYISSVSWIKEGNYLAVGTSNSEVQLWDVQQQKRLRNMTSHSSRVGALSWNNHILSSGSRTGHIHHHDVRVAQHHVSTLTGHTQEVCGLKWSPDGRYLASGANDNLVNVWPCVQGDSGEFSPVQTFTQHQGAVKAVAWCPWQSNVLATGGGTSDRHIRIWNVCSGTCLNSVDTHSQVCSILWSTNYKELISGHGFAQNQLVLWKYPTMTRVTELKGHTARVLNLAISPDGCTVASAAADETLRLWKCFEVDPVTKKEKEKARSSKSIIHQSIR
Donor tissue: neurula