ORFeome > cdx2 – XORFeome 2.0

cdx2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis caudal type homeobox 2, mRNA (cDNA clone MGC:75839 IMAGE:5382575), complete cds
Gene Symbol: cdx2
Gene ID: 394817
ORF gb_acc: MG133041
ORF ID: 10440

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC063344

Library Location

Plate ID: GDExt11005
Well Location: F02

EST Sequences

Clone: MGC:75839 IMAGE:5382575
Trimmed Sequence: ATGTACGTGAGTTACTTGTTGGAGAAGGACGCTGCCATGTACCCTGGATCTATGCGTGCCCACCCGGGGCTACAGAACTACCCTGCTGCCCCCCAGTACCCTGACTATGGGAGCTACCATGGCATGGGGCTAGATCATGGGGCACCTTCCTCTGGTTCCTCAGCTGGCTGGATCACCCCATATGGACCCCCTAGGGATGAATGGGGGGTCCATCCAACTTACTCCCCTGGGCACACTCACATTAACCCTTCTCCTGTGGGCAACATGGCCTTTAGCCCCGACTACTCCCCAGCGCAGGTGCAGGGGCAGCCTTGTGTTGGGGTATTACCGGCTGGGCCCCCCCCTCAGCTATCGCCGGGCTCGGAAGATGGGCACCGACGGCATCACTACGAATGGCTCAGGAAACCAGTCTCCCAGGCAAGCACAGGATCCAAGACAAGGACAAAGGACAAGTATCGGGTTGTATACACGGACCAGCAGCGGCTGGAGCTGGAGAAGGAGTTCCATTACAGCAGATATATTACTATAAGGAGGAAGGCAGAGCTGGCGGCCAATCTGGGGCTTTCGGAGAGACAGGTAAAGATCTGGTTCCAAAACAGAAGAGCCAAAGAAAGAAAAATCACCAAGAAAAGGATCCAGCAGACTCAGACTGGCCAAAATGGACCAGACACTCTCAGCCCAGAACCTTCCATTACCCACCACATGATACCACATGCTACAAGTAATGTGGGGGGCTTGCCTAATACTGTCACACAGTGA
Full Trace Sequence: cgggccaatgggcgtgcggcgctgggagtgagaggagcttgtcgggcagctcacaggctggggccgggaactcacgcaaaggggctgcttggggcatctctgctggcagccagaggggcacaggattatgcagctagctggcacccccctgccgccatgtacgtgagttacttgttggagaaggacgctgccatgtaccctggatctatgcgtgcccacccggggctacagaactaccctgctgccccccagtaccctgactatgggagctaccatggcatggggctagatcatggggcaccttcctctggttcctcagctggctggatcaccccatatggaccccctagggatgaatggggggtccatccaacttactcccctgggcacactcacattaacccttctcctgtgggcaacatggcctttagccccgactactccccagcgcaggtgcaggggcagccttgtgttggggtattaccggctgggcccccccctcagctatcgccgggctcggaagatgggcaccgacggcatcactacgaatggctcaggaaaccagtctcccaggcaagcacaggatccaagacaaggacaaaggacaagtatcgggttgtatacacggaccagcagcggctggagctggagaaggagttccattacagcagatatattactataaggaggaaggcagagctggcggccaatctggggctttcggagagacaggtaaagatctggttccaaaacagaagagccaaagaaagaaaaatcaccaagaaaaggatccagcagactcagactggccaaaatggaccagacactctcagcccagaaccttccattacccaccacatgataccacatgctacaagtaatgtggggggcttgcctaatactgtcacacagtgaaacccccttaacgttcgaccatgagcagctctcacagacactgactggcccactctctggatccccagctggttggagatggacccagatggcgctgtttgtgtgtggaagtcacttggaatgagatttcttagttggttggactgatggggagctagcccctggttatatatgccattggggctactaacagtaccacctgcctacccaggctcttcctggcacccaccctgtctataccactagggtctgctaacagtagcatacacctacccgggctcagactgctattcattgggtatgtacctctgggggttactgacagcaccctaggactcctgcgtactcatatagacttttacatgaaatcacttttctatgagattgaagggttaggccccaggctttaaaatatgcagttaattttaatatatttgtacataaaattgtaacaaaaatgatatttttatgtgatattgtatgtctcagggattatttgtttacttccatatgactgtgcaggatgggttcttacagaggtataggctggctgtctatatgtaatggcaactttgccagttaatgggaatagatgcaaggggggagaaatattctgttaaacattaaccatctttaaagcagatgataatatgtaatgcgcccagcagcctttcccctatccaatggaaagagaccctatcctgtaagccagggctgtccaactggaggcccgcaggctggatatggttctgtgaaggatttttatggtctctctagtctgctcaaacgctaacatttcctgtggcttgaagattagaggcctcattcactaagggttcttacacacaggcatttataagtgtattcccttcctgcaacactggtgtgtgtttcacccagggccctatctaccatatagatacccaatggcctgttcctagggtggcagatttaggggtgcctaaataggaacaatcattgtgcagaaaaaaaattcccctcaagcagacgcaccagacctacatacagccctggttccaccctacagcaacgcaggagttaactgaccccattcttctctatagggactgtaccacatgtaaacatgtaagtggaaataaaaactgtgccagtgtccaattttatctgcactcctgtgggcacagccctcatagggaaatctgacctgcacttacacctgtgggtaagagcccttacatacactctttcttggcacaaaaacacagacattgcacaaattaaaatgccaaatacagagaggttgcgcttctctaatgctgcttcttcaagtgaatgaggttctaggtgcaaggaacaggggagccagggaaccctactgttattattaggctttcatttcagctttttattaagcagttagatgggtcaggcaaatggcactgcagctttcagcattccagctactgggagttgtagttatgtccccagttaacacaacagcttgtctctctcctgcgcactatagtaaagcaatcatgttaagagaagtttacaccagaactcagggcatttgcacctctccctgctggcatttggctgtgcacattgttcgggtcggcaatgaagattaatggagaatcaatacccgggaatcctgcagcaaggaactgtgaattaatgtgctatgtgtgttttttttaccctctctgtatttgcaaagaaactaaagaaagtttgaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MYVSYLLEKDAAMYPGSMRAHPGLQNYPAAPQYPDYGSYHGMGLDHGAPSSGSSAGWITPYGPPRDEWGVHPTYSPGHTHINPSPVGNMAFSPDYSPAQVQGQPCVGVLPAGPPPQLSPGSEDGHRRHHYEWLRKPVSQASTGSKTRTKDKYRVVYTDQQRLELEKEFHYSRYITIRRKAELAANLGLSERQVKIWFQNRRAKERKITKKRIQQTQTGQNGPDTLSPEPSITHHMIPHATSNVGGLPNTVTQ
Donor tissue: neurula